Rh4BG440400

Oxygen evolving enhancer protein 3 (PsbQ)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
58066172 .. 58067506
1335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG440400.1

Sequence Viewer

Length: 384 bp
ATGACATACCCTTGTTTTCAAGAAGACCATCCAGGTCATGATAAAATGGTGGATATGCAATCAAAAGGAATTGCTTGTAGGATTAAGAAGTGTGCCTATGAATTGCTGTCGATTGGTGGTGATCTGATGGACGACGCTTACTCGTGGGACTTGAAGGGAAGGGATATACGCCTCAAATCGATGTTCTTGTATTGCGATCTAAGTCAGTTGATCTCTAACGTCCCAAAGGATCAGAAGAAGGCCCTGACAGAAGTTGGCAACAAATTGTTTTCCTCCATCGAAGAGTTGGATCATGCAGTGAAAATTCGTAGCATTCCATTGACTCAAGACCGATACAACGAGGCCGGTGTCATTCTACAGGAGCTGATGGTTCTCATGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.5

Weight (kDa)

5.56

Isoelectric Point (pI)

40.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbQ PF05757 18 - 127 1.5e-22 Oxygen evolving enhancer protein 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 237, 297
AcsI RAATTY 1 cut(s) 303
AgsI TTSAA 2 cut(s) 20, 154
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 1 cut(s) 364
AluI AGCT 1 cut(s) 364
AlwI GGATC 2 cut(s) 237, 297
AlwNI CAGNNNCTG 1 cut(s) 364
AoxI GGCC 2 cut(s) 240, 342
ApoI RAATTY 1 cut(s) 303
AspS9I GGNCC 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 131
BauI CACGAG 1 cut(s) 142
BbsI GAAGAC 1 cut(s) 30
BccI CCATC 4 cut(s) 36, 121, 284, 361
BciT130I CCWGG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 356
Bme1390I CCNGG 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 241
BmrFI CCNGG 1 cut(s) 33
BpiI GAAGAC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 309
Bsa29I ATCGAT 1 cut(s) 179
Bse118I RCCGGY 1 cut(s) 344
BseBI CCWGG 1 cut(s) 33
BseCI ATCGAT 1 cut(s) 179
BseGI GGATG 1 cut(s) 28
BshFI GGCC 2 cut(s) 242, 344
BshVI ATCGAT 1 cut(s) 179
BsiSI CCGG 1 cut(s) 345
BslFI GGGAC 2 cut(s) 161, 206
BsmFI GGGAC 2 cut(s) 161, 206
BsmI GAATGC 1 cut(s) 312
BsnI GGCC 2 cut(s) 242, 344
Bsp143I GATC 5 cut(s) 121, 196, 210, 229, 289
BspANI GGCC 2 cut(s) 242, 344
BspDI ATCGAT 1 cut(s) 179
BspHI TCATGA 1 cut(s) 37
BspPI GGATC 2 cut(s) 237, 297
BsrFI RCCGGY 1 cut(s) 344
BssAI RCCGGY 1 cut(s) 344
BssMI GATC 5 cut(s) 121, 196, 210, 229, 289
BssSI CACGAG 1 cut(s) 142
Bst2BI CACGAG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 276
BstDEI CTNAG 1 cut(s) 200
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 5 cut(s) 124, 199, 213, 232, 292
BstMBI GATC 5 cut(s) 121, 196, 210, 229, 289
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
BstSFI CTRYAG 1 cut(s) 356
BstV2I GAAGAC 1 cut(s) 30
Bsu15I ATCGAT 1 cut(s) 179
BsuRI GGCC 2 cut(s) 242, 344
BsuTUI ATCGAT 1 cut(s) 179
BtsCI GGATG 1 cut(s) 28
BtsI GCAGTG 1 cut(s) 303
BtsIMutI CAGTG 1 cut(s) 303
CaiI CAGNNNCTG 1 cut(s) 364
CciI TCATGA 1 cut(s) 37
Cfr10I RCCGGY 1 cut(s) 344
Cfr13I GGNCC 1 cut(s) 241
ClaI ATCGAT 1 cut(s) 179
CseI GACGC 1 cut(s) 143
CviAII CATG 3 cut(s) 38, 293, 376
CviJI RGCY 3 cut(s) 242, 344, 364
CviKI_1 RGCY 3 cut(s) 242, 344, 364
DdeI CTNAG 1 cut(s) 200
DpnI GATC 5 cut(s) 123, 198, 212, 231, 291
DpnII GATC 5 cut(s) 121, 196, 210, 229, 289
Eam1104I CTCTTC 1 cut(s) 276
EarI CTCTTC 1 cut(s) 276
EcoO109I RGGNCCY 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 3 cut(s) 41, 296, 379
FaiI YATR 7 cut(s) 7, 39, 56, 99, 167, 294, 377
FaqI GGGAC 2 cut(s) 161, 206
FatI CATG 3 cut(s) 37, 292, 375
FokI GGATG 1 cut(s) 15
HaeIII GGCC 2 cut(s) 242, 344
HapII CCGG 1 cut(s) 345
HgaI GACGC 1 cut(s) 143
Hin1II CATG 3 cut(s) 41, 296, 379
HinfI GANTC 1 cut(s) 322
HpaII CCGG 1 cut(s) 345
HphI GGTGA 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 126, 234
Hpy188III TCNNGA 3 cut(s) 20, 38, 326
Hpy99I CGWCG 1 cut(s) 137
HpyAV CCTTC 3 cut(s) 148, 153, 232
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 2 cut(s) 58, 296
HpyF3I CTNAG 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 3 cut(s) 41, 296, 379
Kzo9I GATC 5 cut(s) 121, 196, 210, 229, 289
LmnI GCTCC 1 cut(s) 361
LpnPI CCDG 5 cut(s) 18, 45, 257, 344, 358
MaeII ACGT 1 cut(s) 219
MalI GATC 5 cut(s) 123, 198, 212, 231, 291
MboI GATC 5 cut(s) 121, 196, 210, 229, 289
MboII GAAGA 3 cut(s) 35, 247, 293
MluCI AATT 4 cut(s) 69, 101, 263, 303
MlyI GAGTC 1 cut(s) 316
MmeI TCCRAC 1 cut(s) 267
MnlI CCTC 3 cut(s) 182, 283, 334
MseI TTAA 1 cut(s) 84
MspI CCGG 1 cut(s) 345
MspR9I CCNGG 1 cut(s) 33
Mva1269I GAATGC 1 cut(s) 312
MvaI CCWGG 1 cut(s) 33
NdeII GATC 5 cut(s) 121, 196, 210, 229, 289
NlaIII CATG 3 cut(s) 41, 296, 379
PagI TCATGA 1 cut(s) 37
PctI GAATGC 1 cut(s) 312
PleI GAGTC 1 cut(s) 316
PpsI GAGTC 1 cut(s) 316
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PspPI GGNCC 1 cut(s) 241
PstNI CAGNNNCTG 1 cut(s) 364
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 5 cut(s) 121, 196, 210, 229, 289
Sau96I GGNCC 1 cut(s) 241
SchI GAGTC 1 cut(s) 316
ScrFI CCNGG 1 cut(s) 33
SetI ASST 3 cut(s) 37, 222, 366
SfcI CTRYAG 1 cut(s) 356
SmlI CTYRAG 1 cut(s) 324
SmoI CTYRAG 1 cut(s) 324
Sse9I AATT 4 cut(s) 69, 101, 263, 303
StyD4I CCNGG 1 cut(s) 31
TaiI ACGT 1 cut(s) 222
TaqI TCGA 3 cut(s) 110, 179, 279
TaqII GACCGA 1 cut(s) 345
TasI AATT 4 cut(s) 69, 101, 263, 303
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 1 cut(s) 303
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 1 cut(s) 303
XapI RAATTY 1 cut(s) 303
XcmI CCANNNNNNNNNTGG 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.