RchiOBHm_Chr3g0478341

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
24146313 .. 24147546
1234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGACGTGCTTCCAAGCTTGGAGGAACAAAGACTGTACATTTTGGAACTTGCTGATATTCTCGTGGAGAGACCATCACAATATGCAAAGGAGAGTGGAAGAAATATTTCTTATATTCAAGAACTTGCATCATCTTCTGAACTCATTGCGCCCCCATCAGGCTAGGGTAACACTAATTCACATTTTAGAACTTCAGATAAAACGACGTAAACAAGTTGTTGAGGATATAAAGAGGTATGTTCTCAACAATTATTAA

Protein Analysis

84

Amino Acids

10.53

Weight (kDa)

10.13

Isoelectric Point (pI)

66.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 13 - 79 1.3e-16 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 176
AfaI GTAC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 157
AgsI TTSAA 1 cut(s) 118
AjiI CACGTC 1 cut(s) 6
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
Alw26I GTCTC 1 cut(s) 63
Asp700I GAANNNNTTC 1 cut(s) 105
AspLEI GCGC 1 cut(s) 150
BauI CACGAG 1 cut(s) 61
BccI CCATC 2 cut(s) 81, 162
BcoDI GTCTC 1 cut(s) 63
BfaI CTAG 1 cut(s) 162
BmgBI CACGTC 1 cut(s) 6
BmsI GCATC 1 cut(s) 136
BsaI GGTCTC 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse3DI GCAATG 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMI GCAATG 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 157
BsmAI GTCTC 1 cut(s) 63
Bso31I GGTCTC 1 cut(s) 63
Bsp1407I TGTACA 1 cut(s) 35
BspTNI GGTCTC 1 cut(s) 63
BsrDI GCAATG 1 cut(s) 143
BsrGI TGTACA 1 cut(s) 35
BssSI CACGAG 1 cut(s) 61
Bst2BI CACGAG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 35
BstAUI TGTACA 1 cut(s) 35
BstHHI GCGC 1 cut(s) 150
BstMAI GTCTC 1 cut(s) 63
BtrI CACGTC 1 cut(s) 6
CfoI GCGC 1 cut(s) 150
Csp6I GTAC 1 cut(s) 36
CviJI RGCY 2 cut(s) 17, 161
CviKI_1 RGCY 2 cut(s) 17, 161
CviQI GTAC 1 cut(s) 36
Eco31I GGTCTC 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 176
FaiI YATR 4 cut(s) 83, 113, 227, 237
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 149
HhaI GCGC 1 cut(s) 150
Hin6I GCGC 1 cut(s) 148
HinP1I GCGC 1 cut(s) 148
HindIII AAGCTT 1 cut(s) 15
Hpy166II GTNNAC 1 cut(s) 209
Hpy188I TCNGA 2 cut(s) 138, 195
Hpy188III TCNNGA 1 cut(s) 118
Hpy8I GTNNAC 1 cut(s) 209
Hpy99I CGWCG 1 cut(s) 207
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4IV ACGT 2 cut(s) 5, 205
HpyCH4V TGCA 2 cut(s) 85, 127
HpySE526I ACGT 2 cut(s) 5, 205
HspAI GCGC 1 cut(s) 148
LpnPI CCDG 1 cut(s) 143
LweI GCATC 1 cut(s) 136
MaeI CTAG 1 cut(s) 162
MaeII ACGT 2 cut(s) 5, 205
MaeIII GTNAC 1 cut(s) 166
MboII GAAGA 2 cut(s) 110, 125
MluCI AATT 2 cut(s) 174, 247
MnlI CCTC 3 cut(s) 15, 214, 225
MroXI GAANNNNTTC 1 cut(s) 105
MseI TTAA 1 cut(s) 253
PdmI GAANNNNTTC 1 cut(s) 105
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 253
SetI ASST 4 cut(s) 8, 19, 208, 236
SfaNI GCATC 1 cut(s) 136
Sse9I AATT 2 cut(s) 174, 247
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 162
TaaI ACNGT 1 cut(s) 35
TaiI ACGT 2 cut(s) 8, 208
TasI AATT 2 cut(s) 174, 247
TatI WGTACW 1 cut(s) 35
Tru1I TTAA 1 cut(s) 253
Tru9I TTAA 1 cut(s) 253
XmnI GAANNNNTTC 1 cut(s) 105
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.