Rh3CG246700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
23795882 .. 23796479
598 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG246700.1

Sequence Viewer

Length: 174 bp
ATGTTGGGAATTAGGCTGCTCGGACAGATGACCTACTTCCAAGCTTGGAAGAACAGGGAGTGCGTCAACTGTACCCAAAAGGCCCAAATATTGGTACGTCTACCTCCAGAAGAAAGAATCTTTATTAAGACAAAAGCTGTAGGGTACATGCAGTGGACAAGTAGTTCACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.7

Weight (kDa)

9.78

Isoelectric Point (pI)

43.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 91
AccI GTMKAC 1 cut(s) 100
AfaI GTAC 3 cut(s) 73, 96, 146
AfiI CCNNNNNNNGG 1 cut(s) 91
AloI GAACNNNNNNTCC 1 cut(s) 148
AluBI AGCT 2 cut(s) 44, 137
AluI AGCT 2 cut(s) 44, 137
AoxI GGCC 1 cut(s) 81
ApeKI GCWGC 1 cut(s) 16
AspS9I GGNCC 1 cut(s) 82
BbvI GCAGC 1 cut(s) 3
BfaI CTAG 1 cut(s) 172
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 1 cut(s) 17
BlsI GCNGC 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 82
BpmI CTGGAG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 91
BseXI GCAGC 1 cut(s) 3
BshFI GGCC 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 91
BsnI GGCC 1 cut(s) 83
BspANI GGCC 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 151
BstSFI CTRYAG 1 cut(s) 138
BstV1I GCAGC 1 cut(s) 3
BsuRI GGCC 1 cut(s) 83
BtsI GCAGTG 1 cut(s) 158
BtsIMutI CAGTG 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 82
CseI GACGC 1 cut(s) 52
Csp6I GTAC 3 cut(s) 72, 95, 145
CviAII CATG 1 cut(s) 148
CviJI RGCY 4 cut(s) 16, 44, 83, 137
CviKI_1 RGCY 4 cut(s) 16, 44, 83, 137
CviQI GTAC 3 cut(s) 72, 95, 145
FaeI CATG 1 cut(s) 151
FaiI YATR 1 cut(s) 149
FatI CATG 1 cut(s) 147
FblI GTMKAC 1 cut(s) 100
Fnu4HI GCNGC 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 17
FspBI CTAG 1 cut(s) 172
GluI GCNGC 1 cut(s) 17
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 83
HgaI GACGC 1 cut(s) 52
Hin1II CATG 1 cut(s) 151
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HindIII AAGCTT 1 cut(s) 42
HinfI GANTC 1 cut(s) 117
Hpy166II GTNNAC 4 cut(s) 67, 101, 156, 167
Hpy188I TCNGA 1 cut(s) 23
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 4 cut(s) 67, 101, 156, 167
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 151
HpySE526I ACGT 1 cut(s) 97
Hsp92II CATG 1 cut(s) 151
LpnPI CCDG 2 cut(s) 40, 120
Lsp1109I GCAGC 1 cut(s) 3
MaeI CTAG 1 cut(s) 172
MaeII ACGT 1 cut(s) 97
MboII GAAGA 2 cut(s) 61, 122
MluCI AATT 1 cut(s) 9
MnlI CCTC 1 cut(s) 114
MseI TTAA 1 cut(s) 126
NlaIII CATG 1 cut(s) 151
NspI RCATGY 1 cut(s) 151
PfeI GAWTC 1 cut(s) 117
PflMI CCANNNNNTGG 1 cut(s) 91
PkrI GCNGC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 82
RsaI GTAC 3 cut(s) 73, 96, 146
RsaNI GTAC 3 cut(s) 72, 95, 145
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 82
SetI ASST 5 cut(s) 35, 46, 100, 106, 139
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 6 cut(s) 32, 53, 57, 67, 119, 160
Sse9I AATT 1 cut(s) 9
SspI AATATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 71
TaiI ACGT 1 cut(s) 100
TasI AATT 1 cut(s) 9
TfiI GAWTC 1 cut(s) 117
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 158
TseI GCWGC 1 cut(s) 16
TspRI CASTG 1 cut(s) 158
Van91I CCANNNNNTGG 1 cut(s) 91
XceI RCATGY 1 cut(s) 151
XmiI GTMKAC 1 cut(s) 100
XspI CTAG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.