Rh3AG218700

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
22340493 .. 22341129
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG218700.1

Sequence Viewer

Length: 231 bp
ATGCAGAGGAGAGTGGAAGAAATATTTCTTATATTCAAGAACTTGCATCATCTGAACTCATTGCGCCCCCATCAGGCTAGGGTAACACTAATTCACATTTTAGAACTTCAGATAAAACGACGTAAACAAGTTGTTGAGGATATAAAGAGGAGGAGAGAAAAAGCACAGGCACTTCTGAAGGAGTCCCTTGAAGCGTTTGAGGACAACGGTGCATCTCTTGTGTTGAAATAG

Protein Analysis

76

Amino Acids

9.09

Weight (kDa)

10.34

Isoelectric Point (pI)

72.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 2 - 59 1.8e-13 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 92, 197
AfiI CCNNNNNNNGG 1 cut(s) 73
AgsI TTSAA 3 cut(s) 37, 191, 226
Asp700I GAANNNNTTC 1 cut(s) 24
AspLEI GCGC 1 cut(s) 66
BccI CCATC 1 cut(s) 78
BfaI CTAG 1 cut(s) 78
BmsI GCATC 2 cut(s) 55, 221
Bsc4I CCNNNNNNNGG 1 cut(s) 73
Bse3DI GCAATG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 73
BseMI GCAATG 1 cut(s) 59
BseRI GAGGAG 3 cut(s) 22, 163, 166
BslFI GGGAC 1 cut(s) 169
BslI CCNNNNNNNGG 1 cut(s) 73
BsmFI GGGAC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 209
BstHHI GCGC 1 cut(s) 66
CfoI GCGC 1 cut(s) 66
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
Eco57I CTGAAG 2 cut(s) 92, 197
FaiI YATR 2 cut(s) 32, 143
FaqI GGGAC 1 cut(s) 169
FspBI CTAG 1 cut(s) 78
GlaI GCGC 1 cut(s) 65
HhaI GCGC 1 cut(s) 66
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HinfI GANTC 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 125
Hpy188I TCNGA 3 cut(s) 54, 111, 177
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 125
Hpy99I CGWCG 1 cut(s) 123
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 3 cut(s) 4, 46, 212
HpySE526I ACGT 1 cut(s) 121
HspAI GCGC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 59, 152
LweI GCATC 2 cut(s) 55, 221
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 82
MboII GAAGA 1 cut(s) 29
MluCI AATT 1 cut(s) 90
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 4 cut(s) 130, 141, 144, 193
MroXI GAANNNNTTC 1 cut(s) 24
PdmI GAANNNNTTC 1 cut(s) 24
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
SchI GAGTC 1 cut(s) 191
SetI ASST 1 cut(s) 124
SfaNI GCATC 2 cut(s) 55, 221
SgeI CNNG 7 cut(s) 49, 55, 86, 90, 140, 179, 200
Sse9I AATT 1 cut(s) 90
SspI AATATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 209
TaiI ACGT 1 cut(s) 124
TasI AATT 1 cut(s) 90
XmnI GAANNNNTTC 1 cut(s) 24
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.