Rh3AG216600

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
21939240 .. 21939880
641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG216600.1

Sequence Viewer

Length: 234 bp
ATGCAGAGGAGAGTGGAAGAAATATTTCTTATATTCAAGAACTTGCATCATCTTCTGAACTCATTGCGCCCCCATCAGGCTAGGGTATCACTAATTCACATTTTAGAACTTCAGATAAAACGACGTAAACAAGTTGTTGAGGATATAAAGGGGAGGAGAGAAAAAGCACAGGCACTTCTGAAGCAGTCCCTCGAATCATTTGAGGACACCGGTGCATCTCTTATGTTGAAATAG

Protein Analysis

77

Amino Acids

9.13

Weight (kDa)

10.35

Isoelectric Point (pI)

67.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 2 - 60 3.3e-16 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 95, 200
AfiI CCNNNNNNNGG 1 cut(s) 76
AgeI ACCGGT 1 cut(s) 209
AgsI TTSAA 2 cut(s) 37, 229
AsiGI ACCGGT 1 cut(s) 209
Asp700I GAANNNNTTC 1 cut(s) 24
AspLEI GCGC 1 cut(s) 69
BccI CCATC 1 cut(s) 81
BfaI CTAG 1 cut(s) 81
BmsI GCATC 2 cut(s) 55, 224
BsaWI WCCGGW 1 cut(s) 209
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse118I RCCGGY 1 cut(s) 209
Bse3DI GCAATG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMI GCAATG 1 cut(s) 62
BseRI GAGGAG 2 cut(s) 22, 169
BshTI ACCGGT 1 cut(s) 209
BsiSI CCGG 1 cut(s) 210
BslFI GGGAC 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 76
BsmFI GGGAC 1 cut(s) 172
BsrDI GCAATG 1 cut(s) 62
BsrFI RCCGGY 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 209
BstHHI GCGC 1 cut(s) 69
CfoI GCGC 1 cut(s) 69
Cfr10I RCCGGY 1 cut(s) 209
CspAI ACCGGT 1 cut(s) 209
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
Eco57I CTGAAG 2 cut(s) 95, 200
FaiI YATR 3 cut(s) 32, 146, 224
FaqI GGGAC 1 cut(s) 172
FspBI CTAG 1 cut(s) 81
GlaI GCGC 1 cut(s) 68
HapII CCGG 1 cut(s) 210
HhaI GCGC 1 cut(s) 69
Hin6I GCGC 1 cut(s) 67
HinP1I GCGC 1 cut(s) 67
HinfI GANTC 1 cut(s) 194
HpaII CCGG 1 cut(s) 210
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 3 cut(s) 57, 114, 180
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 128
Hpy99I CGWCG 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 3 cut(s) 4, 46, 215
HpySE526I ACGT 1 cut(s) 124
HspAI GCGC 1 cut(s) 67
LpnPI CCDG 3 cut(s) 62, 155, 223
LweI GCATC 2 cut(s) 55, 224
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 124
MboII GAAGA 2 cut(s) 29, 44
MluCI AATT 1 cut(s) 93
MnlI CCTC 4 cut(s) 133, 147, 196, 200
MroXI GAANNNNTTC 1 cut(s) 24
MspI CCGG 1 cut(s) 210
PdmI GAANNNNTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 194
PinAI ACCGGT 1 cut(s) 209
SetI ASST 1 cut(s) 127
SfaNI GCATC 2 cut(s) 55, 224
SgeI CNNG 8 cut(s) 49, 55, 89, 93, 143, 182, 203, 222
SgrAI CRCCGGYG 1 cut(s) 209
Sse9I AATT 1 cut(s) 93
SspI AATATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 127
TaqI TCGA 1 cut(s) 192
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 194
XmnI GAANNNNTTC 1 cut(s) 24
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.