RchiOBHm_Chr3g0478211

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
24027445 .. 24028917
1473 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44345

Sequence Viewer

Length: 291 bp
ATGCATTTGAAGTTGCACCTTGGAGGAACAAAGAGTGAGTTAACTGTACCCAAAAGGCCCAAATATTGCTGCACATTTTGGAACTTGCTGATATTCTCGTGGAGAGACCATCACAATATGCAGAGGAGAGTGGAAGAAATATTTCTTATATTCAAGAACTTGCATCATCTTCTGAACTCATTGCGCCCCCATCAGGCTAGGGTAACACTAATTCACATTTTAGAACTTCAGATAAAACGACGTAAACAAGTTGTTGAGGATATAAAGAGGTATGTTCTCAACAATTATTGA

Protein Analysis

96

Amino Acids

11.76

Weight (kDa)

10.24

Isoelectric Point (pI)

69.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 24 - 91 6.6e-17 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 212
AfaI GTAC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 193
AgsI TTSAA 2 cut(s) 10, 154
Alw26I GTCTC 1 cut(s) 99
AoxI GGCC 1 cut(s) 56
ApeKI GCWGC 1 cut(s) 69
Asp700I GAANNNNTTC 1 cut(s) 141
AspLEI GCGC 1 cut(s) 186
AspS9I GGNCC 1 cut(s) 57
BauI CACGAG 1 cut(s) 97
BbvI GCAGC 1 cut(s) 56
BccI CCATC 2 cut(s) 117, 198
BcoDI GTCTC 1 cut(s) 99
BfaI CTAG 1 cut(s) 198
BisI GCNGC 1 cut(s) 70
BlsI GCNGC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 57
BmsI GCATC 1 cut(s) 172
BsaI GGTCTC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 179
BseDI CCNNGG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 179
BseRI GAGGAG 1 cut(s) 139
BseXI GCAGC 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 55
BshFI GGCC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 99
BsnI GGCC 1 cut(s) 58
Bso31I GGTCTC 1 cut(s) 99
BspANI GGCC 1 cut(s) 58
BspTNI GGTCTC 1 cut(s) 99
BsrDI GCAATG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 19
BssSI CACGAG 1 cut(s) 97
BssT1I CCWWGG 1 cut(s) 19
Bst2BI CACGAG 1 cut(s) 97
Bst4CI ACNGT 1 cut(s) 46
BstHHI GCGC 1 cut(s) 186
BstMAI GTCTC 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 56
BsuRI GGCC 1 cut(s) 58
CfoI GCGC 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 57
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 2 cut(s) 58, 197
CviKI_1 RGCY 2 cut(s) 58, 197
CviQI GTAC 1 cut(s) 47
Eco130I CCWWGG 1 cut(s) 19
Eco31I GGTCTC 1 cut(s) 99
Eco57I CTGAAG 1 cut(s) 212
EcoT14I CCWWGG 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 19
FaiI YATR 4 cut(s) 119, 149, 263, 273
Fnu4HI GCNGC 1 cut(s) 70
Fsp4HI GCNGC 1 cut(s) 70
FspBI CTAG 1 cut(s) 198
GlaI GCGC 1 cut(s) 185
GluI GCNGC 1 cut(s) 70
HaeIII GGCC 1 cut(s) 58
HhaI GCGC 1 cut(s) 186
Hin6I GCGC 1 cut(s) 184
HinP1I GCGC 1 cut(s) 184
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HpaI GTTAAC 1 cut(s) 42
Hpy166II GTNNAC 2 cut(s) 42, 245
Hpy188I TCNGA 2 cut(s) 174, 231
Hpy188III TCNNGA 1 cut(s) 154
Hpy8I GTNNAC 2 cut(s) 42, 245
Hpy99I CGWCG 1 cut(s) 243
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 241
HpyCH4V TGCA 5 cut(s) 4, 16, 72, 121, 163
HpySE526I ACGT 1 cut(s) 241
HspAI GCGC 1 cut(s) 184
KspAI GTTAAC 1 cut(s) 42
LpnPI CCDG 1 cut(s) 179
Lsp1109I GCAGC 1 cut(s) 56
LweI GCATC 1 cut(s) 172
MaeI CTAG 1 cut(s) 198
MaeII ACGT 1 cut(s) 241
MaeIII GTNAC 1 cut(s) 202
MboII GAAGA 2 cut(s) 146, 161
MluCI AATT 2 cut(s) 210, 283
MnlI CCTC 4 cut(s) 17, 117, 250, 261
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 141
MseI TTAA 1 cut(s) 41
NsiI ATGCAT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 141
PkrI GCNGC 1 cut(s) 71
PspPI GGNCC 1 cut(s) 57
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 41
SatI GCNGC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 57
SetI ASST 3 cut(s) 21, 244, 272
SfaNI GCATC 1 cut(s) 172
SgeI CNNG 9 cut(s) 32, 97, 109, 111, 166, 172, 206, 210, 260
Sse9I AATT 2 cut(s) 210, 283
SspI AATATT 2 cut(s) 65, 141
SspMI CTAG 1 cut(s) 198
StyI CCWWGG 1 cut(s) 19
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 1 cut(s) 244
TasI AATT 2 cut(s) 210, 283
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TseI GCWGC 1 cut(s) 69
XmnI GAANNNNTTC 1 cut(s) 141
XspI CTAG 1 cut(s) 198
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.