Rw0G023440

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig01082
OG0017794
Physical Location & Seq
Reverse (-)
17424 .. 19316
1893 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G023440.1

Sequence Viewer

Length: 306 bp
CCAAAAGGCCCAAATATTGAATTGCAGCTGCACATTTTGGAACTCGCTGATATTCTCGTGGAGAGACCATCACAATATGCAAGGAGAGTGGAAGAAATTTCTCTTATATTCAAGAACTTGCATCATCTTCTGACTCATTGCGGCCCCATCAGGGCAACACTAATTCACATTCTAGAACATCAGATAAAACGACGTAAACAAGCTGAAGCACATGCACTTCTGAAAGAGTCCCTTGAATCGTTGGAGGACACTGGTGCATCTCTTATGTTGAAACAGGGAGTGCTCATGTATGTTCCTACTCAATGA

Protein Analysis

101

Amino Acids

11.54

Weight (kDa)

7.54

Isoelectric Point (pI)

67.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 7 - 70 1.5e-11 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 141
AcsI RAATTY 1 cut(s) 96
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 4 cut(s) 20, 112, 236, 271
AluBI AGCT 2 cut(s) 28, 203
AluI AGCT 2 cut(s) 28, 203
Alw21I GWGCWC 1 cut(s) 285
Alw26I GTCTC 1 cut(s) 58
AoxI GGCC 2 cut(s) 7, 142
ApeKI GCWGC 2 cut(s) 25, 28
ApoI RAATTY 1 cut(s) 96
AspS9I GGNCC 2 cut(s) 8, 143
BauI CACGAG 1 cut(s) 56
Bbv12I GWGCWC 1 cut(s) 285
BbvI GCAGC 2 cut(s) 15, 37
BccI CCATC 2 cut(s) 76, 155
BcoDI GTCTC 1 cut(s) 58
BfaI CTAG 1 cut(s) 173
BisI GCNGC 3 cut(s) 26, 29, 142
BlsI GCNGC 3 cut(s) 27, 30, 143
BmgT120I GGNCC 2 cut(s) 8, 143
BmiI GGNNCC 1 cut(s) 145
BmsI GCATC 2 cut(s) 130, 266
BsaI GGTCTC 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse1I ACTGG 1 cut(s) 256
Bse3DI GCAATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMI GCAATG 1 cut(s) 136
BseNI ACTGG 1 cut(s) 256
BseXI GCAGC 2 cut(s) 15, 37
BsgI GTGCAG 1 cut(s) 14
BshFI GGCC 2 cut(s) 9, 144
BsiHKAI GWGCWC 1 cut(s) 285
BslFI GGGAC 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 58
BsmFI GGGAC 1 cut(s) 214
BsnI GGCC 2 cut(s) 9, 144
Bso31I GGTCTC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 285
BspACI CCGC 1 cut(s) 141
BspANI GGCC 2 cut(s) 9, 144
BspLI GGNNCC 1 cut(s) 145
BspTNI GGTCTC 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 136
BsrI ACTGG 1 cut(s) 256
BssSI CACGAG 1 cut(s) 56
Bst2BI CACGAG 1 cut(s) 56
BstMAI GTCTC 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 215
BstV1I GCAGC 2 cut(s) 15, 37
BsuRI GGCC 2 cut(s) 9, 144
BtsIMutI CAGTG 1 cut(s) 249
Cfr13I GGNCC 2 cut(s) 8, 143
CspCI CAANNNNNGTGG 2 cut(s) 69, 104
CviAII CATG 2 cut(s) 212, 286
CviJI RGCY 4 cut(s) 9, 28, 144, 203
CviKI_1 RGCY 4 cut(s) 9, 28, 144, 203
Eco31I GGTCTC 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 225
FaeI CATG 2 cut(s) 215, 289
FaiI YATR 6 cut(s) 78, 107, 213, 266, 287, 291
FalI AAGNNNNNCTT 2 cut(s) 216, 248
FaqI GGGAC 1 cut(s) 214
FatI CATG 2 cut(s) 211, 285
Fnu4HI GCNGC 3 cut(s) 26, 29, 142
Fsp4HI GCNGC 3 cut(s) 26, 29, 142
FspBI CTAG 1 cut(s) 173
GluI GCNGC 3 cut(s) 26, 29, 142
HaeIII GGCC 2 cut(s) 9, 144
Hin1II CATG 2 cut(s) 215, 289
HinfI GANTC 3 cut(s) 133, 227, 236
Hpy166II GTNNAC 1 cut(s) 197
Hpy188I TCNGA 3 cut(s) 132, 183, 222
Hpy188III TCNNGA 2 cut(s) 112, 173
Hpy8I GTNNAC 1 cut(s) 197
Hpy99I CGWCG 1 cut(s) 195
HpyCH4IV ACGT 1 cut(s) 193
HpyCH4V TGCA 6 cut(s) 25, 31, 80, 121, 215, 257
HpySE526I ACGT 1 cut(s) 193
Hsp92II CATG 2 cut(s) 215, 289
LpnPI CCDG 3 cut(s) 136, 237, 260
Lsp1109I GCAGC 2 cut(s) 15, 37
LweI GCATC 2 cut(s) 130, 266
MaeI CTAG 1 cut(s) 173
MaeII ACGT 1 cut(s) 193
MboII GAAGA 2 cut(s) 104, 119
MhlI GDGCHC 1 cut(s) 285
MluCI AATT 3 cut(s) 20, 96, 162
MlyI GAGTC 2 cut(s) 127, 236
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 1 cut(s) 238
MspA1I CMGCKG 1 cut(s) 28
NlaIII CATG 2 cut(s) 215, 289
NlaIV GGNNCC 1 cut(s) 145
NspI RCATGY 1 cut(s) 215
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 3 cut(s) 27, 30, 143
PleI GAGTC 2 cut(s) 127, 235
PpsI GAGTC 2 cut(s) 127, 235
PspN4I GGNNCC 1 cut(s) 145
PspPI GGNCC 2 cut(s) 8, 143
PvuII CAGCTG 1 cut(s) 28
SatI GCNGC 3 cut(s) 26, 29, 142
Sau96I GGNCC 2 cut(s) 8, 143
SchI GAGTC 2 cut(s) 127, 236
SduI GDGCHC 1 cut(s) 285
SetI ASST 3 cut(s) 30, 196, 205
SfaNI GCATC 2 cut(s) 130, 266
Sse9I AATT 3 cut(s) 20, 96, 162
SsiI CCGC 1 cut(s) 141
SspI AATATT 1 cut(s) 16
SspMI CTAG 1 cut(s) 173
TaiI ACGT 1 cut(s) 196
TasI AATT 3 cut(s) 20, 96, 162
TauI GCSGC 1 cut(s) 144
TfiI GAWTC 1 cut(s) 236
TscAI CASTG 1 cut(s) 256
TseI GCWGC 2 cut(s) 25, 28
TspRI CASTG 1 cut(s) 256
XapI RAATTY 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 172
XceI RCATGY 1 cut(s) 215
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.