RLG00000023659

Kinetochore protein NDC80 homolog

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Reverse (-)
26777448 .. 26778437
990 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000023659

Sequence Viewer

Length: 423 bp
ATGAACCCACGGCCACCGCTACCATCAAGGCCGTTCGACCACTTCCGCCACTACGACTCCAACACTAGCTTCGCCAGTAGCCGCTCCTCCAATGGAATCAACGGCGGCCCCGGAGGCTCCATCTCCAACTTCGACCTCCACAAAGACCGCCCCTACCAACTTCGACCTCTACCAGCAATCCGCCATCTCCACCATCAATTCCTACCTCTCCTCTCACTAATCCAAGTCTTCCTCAAATTCCCAATCCCTCCCGCCAGAAAATATCACCAAATTACTCAAATTCGTCGTCTCCCTCTCGGTGATTGCCAAATTAGAACCCTCCCCAATCAAACCAGACGAGAGAGGAGAGTAAAAGCACAGGCACTTCTGAAGGAGTCCCTTGAATCGTTTGAGGACACTGGTGCATTTCTTATGTTGAAATAG

Protein Analysis

141

Amino Acids

16.16

Weight (kDa)

10.88

Isoelectric Point (pI)

59.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 84
AciI CCGC 7 cut(s) 17, 46, 82, 105, 148, 181, 252
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 2 cut(s) 236, 279
AcuI CTGAAG 1 cut(s) 389
AgsI TTSAA 2 cut(s) 383, 418
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
Alw26I GTCTC 1 cut(s) 293
AoxI GGCC 3 cut(s) 11, 29, 106
ApoI RAATTY 2 cut(s) 236, 279
ArsI GACNNNNNNTTYG 2 cut(s) 271, 303
AspS9I GGNCC 1 cut(s) 107
AsuC2I CCSGG 1 cut(s) 111
AsuHPI GGTGA 2 cut(s) 257, 311
BbsI GAAGAC 1 cut(s) 220
BccI CCATC 4 cut(s) 31, 128, 192, 201
BceAI ACGGC 3 cut(s) 16, 26, 118
BcnI CCSGG 1 cut(s) 111
BcoDI GTCTC 1 cut(s) 293
BfaI CTAG 1 cut(s) 66
BglI GCCNNNNNGGC 1 cut(s) 114
BisI GCNGC 2 cut(s) 82, 106
BlsI GCNGC 2 cut(s) 83, 107
Bme1390I CCNGG 1 cut(s) 111
BmgT120I GGNCC 1 cut(s) 107
BmiI GGNNCC 2 cut(s) 109, 118
BmrFI CCNGG 1 cut(s) 111
BpiI GAAGAC 1 cut(s) 220
BpuMI CCSGG 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 8, 109
BsaXI ACNNNNNCTCC 2 cut(s) 41, 71
Bse1I ACTGG 2 cut(s) 75, 403
BseDI CCNNGG 2 cut(s) 8, 109
BseNI ACTGG 2 cut(s) 75, 403
BseRI GAGGAG 3 cut(s) 76, 200, 358
BshFI GGCC 3 cut(s) 13, 31, 108
BsiSI CCGG 1 cut(s) 111
BslFI GGGAC 1 cut(s) 361
BsmAI GTCTC 1 cut(s) 293
BsmBI CGTCTC 1 cut(s) 293
BsmFI GGGAC 1 cut(s) 361
BsnI GGCC 3 cut(s) 13, 31, 108
BspACI CCGC 7 cut(s) 17, 46, 82, 105, 148, 181, 252
BspANI GGCC 3 cut(s) 13, 31, 108
BspLI GGNNCC 2 cut(s) 109, 118
BsrBI CCGCTC 1 cut(s) 84
BsrI ACTGG 2 cut(s) 75, 403
BssECI CCNNGG 2 cut(s) 8, 109
BstDSI CCRYGG 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 293
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 220
BsuRI GGCC 3 cut(s) 13, 31, 108
BtgI CCRYGG 1 cut(s) 8
BtsIMutI CAGTG 1 cut(s) 396
Cfr13I GGNCC 1 cut(s) 107
CviJI RGCY 6 cut(s) 13, 31, 69, 81, 108, 117
CviKI_1 RGCY 6 cut(s) 13, 31, 69, 81, 108, 117
EaeI YGGCCR 1 cut(s) 11
EciI GGCGGA 2 cut(s) 35, 170
Eco57I CTGAAG 1 cut(s) 389
Esp3I CGTCTC 1 cut(s) 293
FaiI YATR 1 cut(s) 413
FaqI GGGAC 1 cut(s) 361
FauI CCCGC 1 cut(s) 259
Fnu4HI GCNGC 2 cut(s) 82, 106
Fsp4HI GCNGC 2 cut(s) 82, 106
FspBI CTAG 1 cut(s) 66
GluI GCNGC 2 cut(s) 82, 106
HaeIII GGCC 3 cut(s) 13, 31, 108
HapII CCGG 1 cut(s) 111
HinfI GANTC 4 cut(s) 56, 96, 374, 383
HpaII CCGG 1 cut(s) 111
HphI GGTGA 2 cut(s) 257, 311
Hpy188I TCNGA 1 cut(s) 369
Hpy99I CGWCG 1 cut(s) 288
HpyAV CCTTC 1 cut(s) 364
HpyCH4V TGCA 1 cut(s) 404
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
LmnI GCTCC 2 cut(s) 89, 122
LpnPI CCDG 7 cut(s) 88, 124, 186, 268, 344, 346, 384
MaeI CTAG 1 cut(s) 66
MbiI CCGCTC 1 cut(s) 84
MboII GAAGA 1 cut(s) 220
MluCI AATT 5 cut(s) 197, 236, 270, 279, 309
MlyI GAGTC 2 cut(s) 50, 383
MmeI TCCRAC 2 cut(s) 84, 150
MspI CCGG 1 cut(s) 111
MspR9I CCNGG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 114
NciI CCSGG 1 cut(s) 111
NlaIV GGNNCC 2 cut(s) 109, 118
PfeI GAWTC 2 cut(s) 96, 383
PkrI GCNGC 2 cut(s) 83, 107
PleI GAGTC 2 cut(s) 50, 382
PpsI GAGTC 2 cut(s) 50, 382
PspN4I GGNNCC 2 cut(s) 109, 118
PspPI GGNCC 1 cut(s) 107
SatI GCNGC 2 cut(s) 82, 106
Sau96I GGNCC 1 cut(s) 107
SchI GAGTC 2 cut(s) 50, 383
ScrFI CCNGG 1 cut(s) 111
SetI ASST 4 cut(s) 71, 138, 169, 208
Sse9I AATT 5 cut(s) 197, 236, 270, 279, 309
SsiI CCGC 7 cut(s) 17, 46, 82, 105, 148, 181, 252
SspMI CTAG 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 109
TaqI TCGA 3 cut(s) 36, 132, 163
TasI AATT 5 cut(s) 197, 236, 270, 279, 309
TauI GCSGC 2 cut(s) 84, 108
TfiI GAWTC 2 cut(s) 96, 383
TscAI CASTG 1 cut(s) 403
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 403
XapI RAATTY 2 cut(s) 236, 279
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.