RchiOBHm_Chr2g0118541

Belongs to the universal ribosomal protein uS3 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0012759
Physical Location & Seq
Forward (+)
30726102 .. 30726326
225 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGAAAAAGGCTATTGAATTAACTGAGCAGGCAAGTACAAAAGGAATTCAAGTACAAATTTCAGGGCGTATCGACGGAAAAGAAATTGCACGTGTCGAATGGATCAGAGAAGGTAGAGTTCCTCTACAAACCATTCGAGCCAAAATAGATTATTGTTCCTACGCAGTTCGAACTATCTATGGGGTATTAGGTATCAAAATTTGGATATTTGTAGACAAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S3_C

Protein Analysis

74

Amino Acids

8.48

Weight (kDa)

9.46

Isoelectric Point (pI)

18.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S3_C PF00189 1 - 69 1.3e-24 Ribosomal protein S3, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 213
AclWI GGATC 1 cut(s) 110
AcsI RAATTY 3 cut(s) 45, 57, 198
AcvI CACGTG 1 cut(s) 92
AfaI GTAC 2 cut(s) 37, 54
AflIII ACRYGT 1 cut(s) 91
AgsI TTSAA 2 cut(s) 17, 50
AlwI GGATC 1 cut(s) 110
ApoI RAATTY 3 cut(s) 45, 57, 198
AsuII TTCGAA 1 cut(s) 169
BbrPI CACGTG 1 cut(s) 92
Bpu14I TTCGAA 1 cut(s) 169
BsaAI YACGTR 1 cut(s) 92
BseMII CTCAG 1 cut(s) 15
Bsp119I TTCGAA 1 cut(s) 169
Bsp143I GATC 1 cut(s) 102
BspCNI CTCAG 1 cut(s) 16
BspPI GGATC 1 cut(s) 110
BspT104I TTCGAA 1 cut(s) 169
BssMI GATC 1 cut(s) 102
BstBAI YACGTR 1 cut(s) 92
BstBI TTCGAA 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 30
Csp6I GTAC 2 cut(s) 36, 53
CviJI RGCY 2 cut(s) 11, 140
CviKI_1 RGCY 2 cut(s) 11, 140
CviQI GTAC 2 cut(s) 36, 53
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eco72I CACGTG 1 cut(s) 92
EcoRI GAATTC 1 cut(s) 45
FaiI YATR 1 cut(s) 180
FblI GTMKAC 1 cut(s) 213
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 107
Hpy8I GTNNAC 1 cut(s) 214
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 104
HpyCH4IV ACGT 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 24
HpySE526I ACGT 1 cut(s) 91
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 2 cut(s) 14, 48
MaeII ACGT 1 cut(s) 91
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MluCI AATT 5 cut(s) 17, 45, 57, 84, 198
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 20
NdeII GATC 1 cut(s) 102
NspV TTCGAA 1 cut(s) 169
PmaCI CACGTG 1 cut(s) 92
PmlI CACGTG 1 cut(s) 92
Ppu21I YACGTR 1 cut(s) 92
PspCI CACGTG 1 cut(s) 92
RsaI GTAC 2 cut(s) 37, 54
RsaNI GTAC 2 cut(s) 36, 53
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 1 cut(s) 102
SetI ASST 3 cut(s) 94, 115, 193
SfuI TTCGAA 1 cut(s) 169
SgeI CNNG 7 cut(s) 41, 45, 62, 75, 102, 104, 149
Sse9I AATT 5 cut(s) 17, 45, 57, 84, 198
TaiI ACGT 1 cut(s) 94
TaqI TCGA 4 cut(s) 72, 96, 136, 169
TasI AATT 5 cut(s) 17, 45, 57, 84, 198
TatI WGTACW 2 cut(s) 35, 52
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 90
XapI RAATTY 3 cut(s) 45, 57, 198
XmiI GTMKAC 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.