RchiOBHm_Chr2g0135751

TBCC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
52977730 .. 52978029
300 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGCACAAGGATTCTATTGCCGTTGCTAATGTTTGGCCCTCCACCTCAGCTTTCGATATATATTTGTCGGCTTTATCGCCGTTGCAGGTGATGCTTTGTGCCAGAATTGATTGCATTTTTGCTTTAGGGTGGTGGATTGTGCAATGTTGGCTGGGTCATGGTAATCAGGGTGATTGGCATATGTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.05

Weight (kDa)

5.71

Isoelectric Point (pI)

47.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 76
Acc36I ACCTGC 1 cut(s) 76
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AoxI GGCC 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 36
AsuHPI GGTGA 2 cut(s) 100, 182
BbvCI CCTCAGC 1 cut(s) 46
BceAI ACGGC 2 cut(s) 5, 64
BfuAI ACCTGC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 36
BmsI GCATC 1 cut(s) 81
Bpu10I CCTNAGC 1 cut(s) 46
Bse3DI GCAATG 1 cut(s) 149
BseMI GCAATG 1 cut(s) 149
BseMII CTCAG 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 151
BshFI GGCC 1 cut(s) 37
BsnI GGCC 1 cut(s) 37
BspANI GGCC 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 59
BspMI ACCTGC 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 149
BstAPI GCANNNNNTGC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 46
BstMWI GCNNNNNNNGC 2 cut(s) 91, 148
BsuRI GGCC 1 cut(s) 37
BveI ACCTGC 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 36
CviAII CATG 1 cut(s) 158
CviJI RGCY 4 cut(s) 37, 50, 71, 151
CviKI_1 RGCY 4 cut(s) 37, 50, 71, 151
DdeI CTNAG 1 cut(s) 46
FaeI CATG 1 cut(s) 161
FaiI YATR 5 cut(s) 59, 61, 159, 180, 182
FatI CATG 1 cut(s) 157
FauNDI CATATG 1 cut(s) 180
GsaI CCCAGC 1 cut(s) 155
HaeIII GGCC 1 cut(s) 37
Hin1II CATG 1 cut(s) 161
HinfI GANTC 1 cut(s) 11
HphI GGTGA 2 cut(s) 100, 182
HpyCH4V TGCA 4 cut(s) 4, 85, 114, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 148
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 1 cut(s) 161
LpnPI CCDG 4 cut(s) 71, 115, 137, 152
LweI GCATC 1 cut(s) 81
MluCI AATT 1 cut(s) 105
MnlI CCTC 2 cut(s) 49, 55
MwoI GCNNNNNNNGC 2 cut(s) 91, 148
NdeI CATATG 1 cut(s) 180
NlaIII CATG 1 cut(s) 161
PaqCI CACCTGC 1 cut(s) 76
PfeI GAWTC 1 cut(s) 11
PspFI CCCAGC 1 cut(s) 151
PspPI GGNCC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 36
SetI ASST 3 cut(s) 47, 52, 90
SfaNI GCATC 1 cut(s) 81
SgeI CNNG 6 cut(s) 19, 98, 114, 164, 170, 179
Sse9I AATT 1 cut(s) 105
TaqI TCGA 1 cut(s) 54
TasI AATT 1 cut(s) 105
TfiI GAWTC 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.