Rorug03G0182600

TBCC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
15715294 .. 15717185
1892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0182600.1

Sequence Viewer

Length: 294 bp
ATGGATGGATCGTATGAACCTTCAATGTCTAATGGAAGTGACAGTAACGAAATGCAATACAAGGGAGTTCGGTATGATAAGTTGTCTACAGAAGACCTTAAAGGGCAGGAGTTTAAGACTGTGGAGGAAGCTGAGTCCTTTTACAATGCTTATGCAAAGGCTATGGGTTTTGATGTTAGAAGCGACTACAAGAAATTAAGTATACGCATAACAGGGAGAGTCACTTTATTGCGGTTCATTTTATTTTCTTGTGTTCTCCTCCTCACGATAAAACATCTTAATTTCAATGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

11.18

Weight (kDa)

5.84

Isoelectric Point (pI)

36.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 86, 202
AciI CCGC 1 cut(s) 232
AclWI GGATC 1 cut(s) 16
AgsI TTSAA 2 cut(s) 24, 286
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
AlwI GGATC 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 99
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 123
BseRI GAGGAG 2 cut(s) 248, 251
Bsp143I GATC 1 cut(s) 8
BspACI CCGC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 16
BssMI GATC 1 cut(s) 8
BssNAI GTATAC 1 cut(s) 203
Bst1107I GTATAC 1 cut(s) 203
Bst4CI ACNGT 2 cut(s) 44, 121
BstDEI CTNAG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BstSFI CTRYAG 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 99
BstZ17I GTATAC 1 cut(s) 203
BtsCI GGATG 1 cut(s) 10
CviJI RGCY 2 cut(s) 131, 161
CviKI_1 RGCY 2 cut(s) 131, 161
DdeI CTNAG 1 cut(s) 132
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
FaiI YATR 6 cut(s) 15, 75, 153, 164, 203, 209
FblI GTMKAC 2 cut(s) 86, 202
FokI GGATG 1 cut(s) 17
HinfI GANTC 2 cut(s) 134, 219
Hpy166II GTNNAC 2 cut(s) 87, 203
Hpy188III TCNNGA 1 cut(s) 265
Hpy8I GTNNAC 2 cut(s) 87, 203
HpyAV CCTTC 1 cut(s) 30
HpyCH4III ACNGT 2 cut(s) 44, 121
HpyCH4V TGCA 2 cut(s) 55, 155
HpyF3I CTNAG 1 cut(s) 132
Kzo9I GATC 1 cut(s) 8
LpnPI CCDG 2 cut(s) 92, 198
MaeIII GTNAC 3 cut(s) 38, 44, 220
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 1 cut(s) 104
MluCI AATT 2 cut(s) 194, 280
MlyI GAGTC 2 cut(s) 143, 228
MnlI CCTC 3 cut(s) 118, 269, 272
MseI TTAA 4 cut(s) 99, 114, 197, 279
NdeII GATC 1 cut(s) 8
NmuCI GTSAC 2 cut(s) 38, 220
PleI GAGTC 2 cut(s) 142, 227
PpsI GAGTC 2 cut(s) 142, 227
SaqAI TTAA 4 cut(s) 99, 114, 197, 279
Sau3AI GATC 1 cut(s) 8
SchI GAGTC 2 cut(s) 143, 228
SetI ASST 3 cut(s) 22, 99, 133
SfcI CTRYAG 1 cut(s) 87
SgeI CNNG 6 cut(s) 73, 119, 202, 225, 261, 277
Sse9I AATT 2 cut(s) 194, 280
SsiI CCGC 1 cut(s) 232
TaaI ACNGT 2 cut(s) 44, 121
TasI AATT 2 cut(s) 194, 280
Tru1I TTAA 4 cut(s) 99, 114, 197, 279
Tru9I TTAA 4 cut(s) 99, 114, 197, 279
TseFI GTSAC 2 cut(s) 38, 220
Tsp45I GTSAC 2 cut(s) 38, 220
TspDTI ATGAA 2 cut(s) 30, 226
XmiI GTMKAC 2 cut(s) 86, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.