RchiOBHm_Chr1g0322621

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
9944568 .. 9945820
1253 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGCTGCAAGTGGAATCTGTTTGGGTAGGAAAGAAAAAGGTGGCCCCACTTGAGCCTGATGAAGTAGAAATGCTTTTGGGGTTCCCGTGGGACCACACAAGGGGAATAAGCAGGACAGGTGGATACAAGTCACTGGGAAATTCACTCCTGGTGTTCCGTCTTGGATGGGGATGTCTAGGGGTGCTGGTTGGGCCATGGCTGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.54

Weight (kDa)

7.92

Isoelectric Point (pI)

18.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 100
AjnI CCWGG 1 cut(s) 147
AoxI GGCC 2 cut(s) 42, 191
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 139
AspS9I GGNCC 3 cut(s) 43, 91, 191
AvaII GGWCC 1 cut(s) 91
BccI CCATC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 149
BciVI GTATCC 1 cut(s) 116
BfaI CTAG 1 cut(s) 176
BfuI GTATCC 1 cut(s) 116
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 3 cut(s) 43, 91, 191
BmiI GGNNCC 3 cut(s) 45, 83, 92
BmrFI CCNGG 1 cut(s) 149
BmrI ACTGGG 1 cut(s) 143
BmuI ACTGGG 1 cut(s) 143
BpuEI CTTGAG 1 cut(s) 71
BsaJI CCNNGG 2 cut(s) 86, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 100
Bse1I ACTGG 1 cut(s) 138
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 86, 194
BseGI GGATG 2 cut(s) 170, 176
BseLI CCNNNNNNNGG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 138
BshFI GGCC 2 cut(s) 44, 193
BslFI GGGAC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 100
BsmFI GGGAC 1 cut(s) 104
BsnI GGCC 2 cut(s) 44, 193
Bsp143I GATC 1 cut(s) 201
Bsp19I CCATGG 1 cut(s) 194
BspANI GGCC 2 cut(s) 44, 193
BspLI GGNNCC 3 cut(s) 45, 83, 92
BsrI ACTGG 1 cut(s) 138
BssECI CCNNGG 2 cut(s) 86, 194
BssMI GATC 1 cut(s) 201
BssT1I CCWWGG 1 cut(s) 194
Bst2UI CCWGG 1 cut(s) 149
BstDSI CCRYGG 2 cut(s) 86, 194
BstF5I GGATG 2 cut(s) 170, 176
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BstMWI GCNNNNNNNGC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BsuI GTATCC 1 cut(s) 116
BsuRI GGCC 2 cut(s) 44, 193
BtgI CCRYGG 2 cut(s) 86, 194
BtsCI GGATG 2 cut(s) 170, 176
BtsIMutI CAGTG 1 cut(s) 131
Cfr13I GGNCC 3 cut(s) 43, 91, 191
CviAII CATG 1 cut(s) 195
CviJI RGCY 4 cut(s) 44, 55, 193, 199
CviKI_1 RGCY 4 cut(s) 44, 55, 193, 199
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
Eco130I CCWWGG 1 cut(s) 194
Eco47I GGWCC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 1 cut(s) 198
FaiI YATR 1 cut(s) 196
FaqI GGGAC 1 cut(s) 104
FatI CATG 1 cut(s) 194
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 2 cut(s) 177, 183
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 176
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 2 cut(s) 44, 193
Hin1II CATG 1 cut(s) 198
HinfI GANTC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 7
HpyF10VI GCNNNNNNNGC 1 cut(s) 190
Hsp92II CATG 1 cut(s) 198
Kzo9I GATC 1 cut(s) 201
LpnPI CCDG 7 cut(s) 69, 97, 102, 119, 134, 161, 170
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 129
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MluCI AATT 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 190
NcoI CCATGG 1 cut(s) 194
NdeII GATC 1 cut(s) 201
NlaIII CATG 1 cut(s) 198
NlaIV GGNNCC 3 cut(s) 45, 83, 92
NmuCI GTSAC 1 cut(s) 129
PfeI GAWTC 1 cut(s) 14
PkrI GCNGC 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
PspN4I GGNNCC 3 cut(s) 45, 83, 92
PspPI GGNCC 3 cut(s) 43, 91, 191
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 201
Sau96I GGNCC 3 cut(s) 43, 91, 191
ScrFI CCNGG 1 cut(s) 149
SetI ASST 2 cut(s) 42, 121
SinI GGWCC 1 cut(s) 91
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 194
TasI AATT 1 cut(s) 139
TfiI GAWTC 1 cut(s) 14
TscAI CASTG 1 cut(s) 138
TseFI GTSAC 1 cut(s) 129
TseI GCWGC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 75
TspGWI ACGGA 1 cut(s) 146
TspRI CASTG 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 91
XapI RAATTY 1 cut(s) 139
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.