RchiOBHm_Chr1g0321591

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
9099694 .. 9100115
422 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55163

Sequence Viewer

Length: 168 bp
ATGAAGGCTCTCAAAGACTATGACGAAGATGAAATGCCACCTGAAAGTGTCCGTGGCTATGTTCTTTATGAATGCCGCAAGTGGAATCTTGTTTGGGTAGGAAAGAAAAAGGTGGCCCCACTTGAGCCTGATCAAGTGGAAATGCTTTTGGGGTTCCCAGGGACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.4

Weight (kDa)

4.93

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 76
AjnI CCWGG 1 cut(s) 157
AoxI GGCC 1 cut(s) 114
AspS9I GGNCC 2 cut(s) 115, 162
AvaII GGWCC 1 cut(s) 162
BciT130I CCWGG 1 cut(s) 159
BclI TGATCA 1 cut(s) 130
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 162
BmgT120I GGNCC 2 cut(s) 115, 162
BmiI GGNNCC 3 cut(s) 117, 155, 163
BmrFI CCNGG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 143
BsaJI CCNNGG 3 cut(s) 52, 157, 158
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 3 cut(s) 52, 157, 158
BshFI GGCC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 77
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 1 cut(s) 76
BspANI GGCC 1 cut(s) 116
BspLI GGNNCC 3 cut(s) 117, 155, 163
BssECI CCNNGG 3 cut(s) 52, 157, 158
BssMI GATC 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 159
BstDSI CCRYGG 1 cut(s) 52
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BsuRI GGCC 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 52
Cfr13I GGNCC 2 cut(s) 115, 162
CviJI RGCY 4 cut(s) 8, 57, 116, 127
CviKI_1 RGCY 4 cut(s) 8, 57, 116, 127
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 162
EcoO109I RGGNCCY 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 157
FaiI YATR 3 cut(s) 21, 60, 69
FbaI TGATCA 1 cut(s) 130
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
GluI GCNGC 1 cut(s) 76
HaeIII GGCC 1 cut(s) 116
HinfI GANTC 1 cut(s) 85
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 54, 141, 144
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 159
Mva1269I GAATGC 1 cut(s) 77
MvaI CCWGG 1 cut(s) 159
NdeII GATC 1 cut(s) 130
NlaIV GGNNCC 3 cut(s) 117, 155, 163
PasI CCCWGGG 1 cut(s) 158
PctI GAATGC 1 cut(s) 77
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 77
PpuMI RGGWCCY 1 cut(s) 162
Psp5II RGGWCCY 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 3 cut(s) 117, 155, 163
PspPI GGNCC 2 cut(s) 115, 162
PspPPI RGGWCCY 1 cut(s) 162
SatI GCNGC 1 cut(s) 76
Sau3AI GATC 1 cut(s) 130
Sau96I GGNCC 2 cut(s) 115, 162
ScrFI CCNGG 1 cut(s) 159
SetI ASST 3 cut(s) 43, 114, 167
SgeI CNNG 7 cut(s) 53, 65, 91, 101, 134, 140, 146
SinI GGWCC 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
SsiI CCGC 1 cut(s) 76
StyD4I CCNGG 1 cut(s) 157
TauI GCSGC 1 cut(s) 78
TfiI GAWTC 1 cut(s) 85
TspDTI ATGAA 3 cut(s) 17, 45, 84
TspGWI ACGGA 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.