RchiOBHm_Chr1g0322761

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
10147735 .. 10148158
424 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
ATGACAAAGAGGTGGTGGCCTACTTTGGGTGATCGGACAAAGCTAAATTGCTTACAGACTTGCGTTGCTAGTGCAACAATTACTGAGAGGATCATGAAGGCTCTTAAAGACTATGATGAAGATGAAATCCCACCTGAAAGTGTCCATCGCTATGTTCTTTATGAATGCCGCAAGTGGAATCTTGTTTGGGTAGGAAAGAAAAAGGTGGCCTCACTTGAGCTTGATGAAGTTGAAATGCTTTTGGGTTCTCAAGGGACCACACAAGGGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.43

Weight (kDa)

5.85

Isoelectric Point (pI)

36.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 98
AfiI CCNNNNNNNGG 2 cut(s) 26, 264
AgsI TTSAA 1 cut(s) 233
AluBI AGCT 2 cut(s) 43, 220
AluI AGCT 2 cut(s) 43, 220
AlwI GGATC 1 cut(s) 98
AoxI GGCC 2 cut(s) 17, 207
AspS9I GGNCC 1 cut(s) 255
AsuHPI GGTGA 1 cut(s) 41
AvaII GGWCC 1 cut(s) 255
BccI CCATC 1 cut(s) 153
BfaI CTAG 1 cut(s) 69
BisI GCNGC 1 cut(s) 169
BlsI GCNGC 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 255
BmgT120I GGNCC 1 cut(s) 255
BmiI GGNNCC 1 cut(s) 256
BpuEI CTTGAG 2 cut(s) 234, 236
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 264
BseLI CCNNNNNNNGG 2 cut(s) 26, 264
BseMII CTCAG 1 cut(s) 75
BshFI GGCC 2 cut(s) 19, 209
BslFI GGGAC 1 cut(s) 268
BslI CCNNNNNNNGG 2 cut(s) 26, 264
BsmFI GGGAC 1 cut(s) 268
BsmI GAATGC 1 cut(s) 170
BsnI GGCC 2 cut(s) 19, 209
Bsp143I GATC 2 cut(s) 31, 90
BspACI CCGC 1 cut(s) 169
BspANI GGCC 2 cut(s) 19, 209
BspCNI CTCAG 1 cut(s) 76
BspHI TCATGA 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 256
BspPI GGATC 1 cut(s) 98
BssMI GATC 2 cut(s) 31, 90
BstDEI CTNAG 1 cut(s) 84
BstKTI GATC 2 cut(s) 34, 93
BstMBI GATC 2 cut(s) 31, 90
BsuRI GGCC 2 cut(s) 19, 209
BtgZI GCGATG 1 cut(s) 131
CciI TCATGA 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 255
CviAII CATG 1 cut(s) 94
CviJI RGCY 5 cut(s) 19, 43, 101, 209, 220
CviKI_1 RGCY 5 cut(s) 19, 43, 101, 209, 220
DdeI CTNAG 1 cut(s) 84
DpnI GATC 2 cut(s) 33, 92
DpnII GATC 2 cut(s) 31, 90
Eco47I GGWCC 1 cut(s) 255
FaeI CATG 1 cut(s) 97
FaiI YATR 4 cut(s) 95, 114, 153, 162
FaqI GGGAC 1 cut(s) 268
FatI CATG 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 169
Fsp4HI GCNGC 1 cut(s) 169
FspBI CTAG 1 cut(s) 69
GluI GCNGC 1 cut(s) 169
HaeIII GGCC 2 cut(s) 19, 209
Hin1II CATG 1 cut(s) 97
HinfI GANTC 1 cut(s) 178
HphI GGTGA 1 cut(s) 41
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 1 cut(s) 97
Kzo9I GATC 2 cut(s) 31, 90
LpnPI CCDG 1 cut(s) 147
MaeI CTAG 1 cut(s) 69
MalI GATC 2 cut(s) 33, 92
MboI GATC 2 cut(s) 31, 90
MboII GAAGA 1 cut(s) 131
MluCI AATT 2 cut(s) 46, 78
MnlI CCTC 3 cut(s) 3, 81, 220
MseI TTAA 1 cut(s) 105
MslI CAYNNNNRTG 1 cut(s) 150
Mva1269I GAATGC 1 cut(s) 170
NdeII GATC 2 cut(s) 31, 90
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 256
PagI TCATGA 1 cut(s) 93
PctI GAATGC 1 cut(s) 170
PfeI GAWTC 1 cut(s) 178
PkrI GCNGC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 256
PspPI GGNCC 1 cut(s) 255
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 105
SatI GCNGC 1 cut(s) 169
Sau3AI GATC 2 cut(s) 31, 90
Sau96I GGNCC 1 cut(s) 255
SetI ASST 5 cut(s) 14, 45, 136, 207, 222
SgeI CNNG 9 cut(s) 72, 81, 106, 146, 184, 194, 227, 233, 263
SinI GGWCC 1 cut(s) 255
SmiMI CAYNNNNRTG 1 cut(s) 150
SmlI CTYRAG 2 cut(s) 215, 249
SmoI CTYRAG 2 cut(s) 215, 249
Sse9I AATT 2 cut(s) 46, 78
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 69
TasI AATT 2 cut(s) 46, 78
TauI GCSGC 1 cut(s) 171
TfiI GAWTC 1 cut(s) 178
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TspDTI ATGAA 5 cut(s) 110, 132, 138, 177, 240
VpaK11BI GGWCC 1 cut(s) 255
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.