RchiOBHm_Chr1g0337631

Protein of unknown function (DUF1442)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
29508770 .. 29509174
405 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 405 bp
ATGTGTGACCATATCACTTGTATCATTTCAAACATGAACCCAGAAGTGCTTGTTGGTGAGCCAGAGGAGGTCATGTCTGAGCTTGTGGTAATAGATTTCATGGTTGTGGATTGCAAGCGCAAAGACTATGCCAGGGTTCTAAGGCAGGCTAGGTATCAGAGTGGTGCGTCTTGGTTTGCAAGAATGCCAATTCAAAAAGCGATTCTGGTTTTCAGATGGAAGAATGTTATAAATTGTGGATCAAGAAGGGTGGTTCGGATAGTGTTCTTGCCTGTAGGGAAGGGTTTAGATATGGCTCATGTATCCTGCAGTGGAGGGAATTCAGGGTCAAGCCAAGTAGAGAAGAAGAGATGGATCAAACATTTTGATCAACAATCTGGGGAGGAACATGTTATCAGAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

15.31

Weight (kDa)

9.27

Isoelectric Point (pI)

64.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1442 PF07279 11 - 134 2.5e-34 Protein of unknown function (DUF1442)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013984)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 230
AclWI GGATC 2 cut(s) 247, 362
AcsI RAATTY 1 cut(s) 319
AflIII ACRYGT 1 cut(s) 388
AgsI TTSAA 2 cut(s) 30, 194
AjnI CCWGG 1 cut(s) 131
AjuI GAANNNNNNNTTGG 2 cut(s) 36, 68
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
AlwI GGATC 2 cut(s) 247, 362
ApoI RAATTY 1 cut(s) 319
AspLEI GCGC 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 68
BccI CCATC 2 cut(s) 210, 345
BciT130I CCWGG 1 cut(s) 133
BciVI GTATCC 1 cut(s) 313
BclI TGATCA 1 cut(s) 367
BfaI CTAG 1 cut(s) 150
BfmI CTRYAG 2 cut(s) 273, 307
BfuI GTATCC 1 cut(s) 313
Bme1390I CCNGG 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 132
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
BseBI CCWGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 80
BsmI GAATGC 1 cut(s) 189
Bsp143I GATC 3 cut(s) 239, 354, 367
BspCNI CTCAG 1 cut(s) 70
BspMAI CTGCAG 1 cut(s) 311
BspPI GGATC 2 cut(s) 247, 362
BssECI CCNNGG 1 cut(s) 132
BssMI GATC 3 cut(s) 239, 354, 367
Bst2UI CCWGG 1 cut(s) 133
Bst6I CTCTTC 1 cut(s) 341
BstC8I GCNNGC 2 cut(s) 116, 147
BstDEI CTNAG 2 cut(s) 78, 140
BstHHI GCGC 1 cut(s) 120
BstKTI GATC 3 cut(s) 242, 357, 370
BstMBI GATC 3 cut(s) 239, 354, 367
BstNI CCWGG 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 392
BstSCI CCNGG 1 cut(s) 131
BstSFI CTRYAG 2 cut(s) 273, 307
BsuI GTATCC 1 cut(s) 313
BtsI GCAGTG 1 cut(s) 316
BtsIMutI CAGTG 1 cut(s) 316
Cac8I GCNNGC 2 cut(s) 116, 147
CfoI GCGC 1 cut(s) 120
CseI GACGC 1 cut(s) 156
CspCI CAANNNNNGTGG 2 cut(s) 231, 266
CviAII CATG 5 cut(s) 34, 73, 100, 299, 389
CviJI RGCY 5 cut(s) 61, 82, 149, 296, 333
CviKI_1 RGCY 5 cut(s) 61, 82, 149, 296, 333
DdeI CTNAG 2 cut(s) 78, 140
DpnI GATC 3 cut(s) 241, 356, 369
DpnII GATC 3 cut(s) 239, 354, 367
Eam1104I CTCTTC 1 cut(s) 341
EarI CTCTTC 1 cut(s) 341
EcoRI GAATTC 1 cut(s) 319
EcoRII CCWGG 1 cut(s) 131
FaeI CATG 5 cut(s) 37, 76, 103, 302, 392
FaiI YATR 9 cut(s) 12, 35, 74, 101, 129, 230, 293, 300, 390
FatI CATG 5 cut(s) 33, 72, 99, 298, 388
FbaI TGATCA 1 cut(s) 367
FspBI CTAG 1 cut(s) 150
GlaI GCGC 1 cut(s) 119
HgaI GACGC 1 cut(s) 156
HhaI GCGC 1 cut(s) 120
Hin1II CATG 5 cut(s) 37, 76, 103, 302, 392
Hin6I GCGC 1 cut(s) 118
HinP1I GCGC 1 cut(s) 118
HinfI GANTC 1 cut(s) 202
HphI GGTGA 1 cut(s) 68
Hpy188I TCNGA 5 cut(s) 79, 159, 215, 258, 398
Hpy188III TCNNGA 1 cut(s) 243
HpyAV CCTTC 2 cut(s) 240, 274
HpyCH4V TGCA 3 cut(s) 114, 179, 309
HpyF3I CTNAG 2 cut(s) 78, 140
Hsp92II CATG 5 cut(s) 37, 76, 103, 302, 392
HspAI GCGC 1 cut(s) 118
Ksp22I TGATCA 1 cut(s) 367
Kzo9I GATC 3 cut(s) 239, 354, 367
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 5
MalI GATC 3 cut(s) 241, 356, 369
MboI GATC 3 cut(s) 239, 354, 367
MboII GAAGA 3 cut(s) 232, 355, 358
MluCI AATT 3 cut(s) 189, 232, 319
MnlI CCTC 4 cut(s) 58, 61, 308, 376
MslI CAYNNNNRTG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 133
Mva1269I GAATGC 1 cut(s) 189
MvaI CCWGG 1 cut(s) 133
NdeII GATC 3 cut(s) 239, 354, 367
NlaIII CATG 5 cut(s) 37, 76, 103, 302, 392
NmuCI GTSAC 1 cut(s) 5
NspI RCATGY 1 cut(s) 392
PciI ACATGT 1 cut(s) 388
PctI GAATGC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 202
PscI ACATGT 1 cut(s) 388
PsiI TTATAA 1 cut(s) 230
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
PstI CTGCAG 1 cut(s) 311
RseI CAYNNNNRTG 1 cut(s) 104
Sau3AI GATC 3 cut(s) 239, 354, 367
ScrFI CCNGG 1 cut(s) 133
SetI ASST 3 cut(s) 72, 84, 155
SfcI CTRYAG 2 cut(s) 273, 307
SmiMI CAYNNNNRTG 1 cut(s) 104
Sse9I AATT 3 cut(s) 189, 232, 319
SspMI CTAG 1 cut(s) 150
StyD4I CCNGG 1 cut(s) 131
TasI AATT 3 cut(s) 189, 232, 319
TfiI GAWTC 1 cut(s) 202
TscAI CASTG 1 cut(s) 316
TseFI GTSAC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 50, 88
TspRI CASTG 1 cut(s) 316
XapI RAATTY 1 cut(s) 319
XceI RCATGY 1 cut(s) 392
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.