Rh6AG501400

Protein of unknown function (DUF1442)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
67548971 .. 67549174
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG501400.1

Sequence Viewer

Length: 204 bp
ATGAACCCAGAAGTGCTTGTTGGTGAGCCAGAGGAGGTCATGTCTGAGCTTGTGGTAATAGATTCCATGGTTGTGGATTGCAAGCGCAAAGACTATGCCAGGGTTCTAAGGCAGGCTAGGTTGAATCAGAGTGGTGCGTCTTGGTTTGCAAGAATGCCAATTCAAAAAGCGATTCTGGTTTCAGATGGAGGAGTAGTGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.45

Weight (kDa)

5.21

Isoelectric Point (pI)

59.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1442 PF07279 3 - 58 3.6e-08 Protein of unknown function (DUF1442)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013984)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 202
AgsI TTSAA 2 cut(s) 124, 164
AjnI CCWGG 1 cut(s) 98
AjuI GAANNNNNNNTTGG 1 cut(s) 35
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AspLEI GCGC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 35
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 100
BfaI CTAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BsaJI CCNNGG 2 cut(s) 66, 99
BsaXI ACNNNNNCTCC 3 cut(s) 26, 56, 180
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 2 cut(s) 66, 99
BseMII CTCAG 1 cut(s) 36
BseRI GAGGAG 2 cut(s) 47, 204
BsmI GAATGC 1 cut(s) 159
Bsp19I CCATGG 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 37
BssECI CCNNGG 2 cut(s) 66, 99
BssT1I CCWWGG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 100
BstC8I GCNNGC 2 cut(s) 83, 114
BstDEI CTNAG 2 cut(s) 45, 107
BstDSI CCRYGG 1 cut(s) 66
BstHHI GCGC 1 cut(s) 87
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
BstXI CCANNNNNNTGG 1 cut(s) 73
BtgI CCRYGG 1 cut(s) 66
Cac8I GCNNGC 2 cut(s) 83, 114
CfoI GCGC 1 cut(s) 87
CseI GACGC 1 cut(s) 126
CviAII CATG 2 cut(s) 40, 67
CviJI RGCY 3 cut(s) 28, 49, 116
CviKI_1 RGCY 3 cut(s) 28, 49, 116
DdeI CTNAG 2 cut(s) 45, 107
Eco130I CCWWGG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaeI CATG 2 cut(s) 43, 70
FaiI YATR 4 cut(s) 41, 68, 96, 202
FatI CATG 2 cut(s) 39, 66
FspBI CTAG 1 cut(s) 117
GlaI GCGC 1 cut(s) 86
HgaI GACGC 1 cut(s) 126
HhaI GCGC 1 cut(s) 87
Hin1II CATG 2 cut(s) 43, 70
Hin6I GCGC 1 cut(s) 85
HinP1I GCGC 1 cut(s) 85
HinfI GANTC 3 cut(s) 62, 124, 172
HphI GGTGA 1 cut(s) 35
Hpy188I TCNGA 3 cut(s) 46, 129, 184
HpyCH4V TGCA 2 cut(s) 81, 149
HpyF3I CTNAG 2 cut(s) 45, 107
Hsp92II CATG 2 cut(s) 43, 70
HspAI GCGC 1 cut(s) 85
LpnPI CCDG 6 cut(s) 21, 42, 85, 98, 112, 161
MaeI CTAG 1 cut(s) 117
MluCI AATT 1 cut(s) 159
MnlI CCTC 3 cut(s) 25, 28, 182
MslI CAYNNNNRTG 1 cut(s) 71
MspR9I CCNGG 1 cut(s) 100
Mva1269I GAATGC 1 cut(s) 159
MvaI CCWGG 1 cut(s) 100
NcoI CCATGG 1 cut(s) 66
NlaIII CATG 2 cut(s) 43, 70
PctI GAATGC 1 cut(s) 159
PfeI GAWTC 3 cut(s) 62, 124, 172
PsiI TTATAA 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 71
ScrFI CCNGG 1 cut(s) 100
SetI ASST 3 cut(s) 39, 51, 122
SmiMI CAYNNNNRTG 1 cut(s) 71
Sse9I AATT 1 cut(s) 159
SspMI CTAG 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 66
TasI AATT 1 cut(s) 159
TfiI GAWTC 3 cut(s) 62, 124, 172
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.