RchiOBHm_Chr1g0351991

ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum. Recognizes and selectively binds the transmembrane domain of TA proteins in the cytosol. This complex then targets to the endoplasmic reticulum by membrane-bound receptors, where the tail- anchored protein is released for insertion. This process is regulated by ATP binding and hydrolysis. ATP binding drives the homodimer towards the closed dimer state, facilitating recognition of newly synthesized TA membrane proteins. ATP hydrolysis is required for insertion. Subsequently, the homodimer reverts towards the open dimer state, lowering its affinity for the membrane-bound receptor, and returning it to the cytosol to initiate a new round of targeting

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0010938
Physical Location & Seq
Reverse (-)
45150396 .. 45155223
4828 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1071 bp
ATGGCAGCCTCTGATTTACCAGAGGGGACTCTTCAGAACGTACTGGAGCAAGAGACCCTCAAGTGGGTCTTCGTTGGCGGCAAAGGTGGGGTTGGCAAAACGACGTGCAGCTCAATCCTATCGATCCTTCTCGCCAGTGTTAGATCCTCTGTTTTGATTATCTCCACCGACCCTGCTCACAATCTCAGCGATGCTTTTCAGCAAAAGTTCACCAAGACTCCTACTTTGGTTAATGGGTTCCCCAATCTATATGCCATGGAAGTGGATCCTACTGTTGAGCATGAAGACATTGGCGGAGAGAATGGAATGGATAGTTTGGTTTCGGAGCTAGCAAATGCTATTCCAGGGATTGATGAGGCCATGAGCTTTGCAGAGATGTTAAAATTGGTTCAAACAATGGATTATTCTGTTATTGTATTTGACACTGCACCGACTGGTCATACGCTTCGGCTGTTGCAGTTTCCATCAACATTGGAGAAAGGTCTCGCAAAAGTGATGTCTTTGAAAAATAAATTTGGCGGTTTAATGAGTCAGATGACGCGCCTCTTTGGTGTTGATGACGAATTTGGAGAGGATGCGATTTTAGGAAAGCTTGAGGGCATGAAAGAAGTAATAGAGCAAGTTAATAAGCAATTCAAAGACCCAGACTTGACAACGTTCGTTTGTGTTTGCATTCCTGAATTCTTGTCTCTCTATGAAACAGAGAGACTGGTGCAGGAACTCACCAAATTTGAGATAGATACGCACAATATTATCATTAACCAAGTACTTTATGATGAAGAAGACTCGCAGTCCAAATTACTTAAAGCAAGAATGCGAATGCAACAAAAGTATCTTGACCAGTTCTACATGTTATATGATGATTTTAACATAACCAAGCTCCCATTGCTGCCTGAAGAGGTTACTGGAGTGGAAGCTCTGAAAGCGTTTTCATGCCATTTTCTGACACCGTATCAACCTTCCACCAGCACGGTGGAATCGTTAGAACAAAGGGTGTCCACGCTAAGGCAGCAGTTGAAAGACACCGAAGCAGAGCTAGAAAGACTAAGAAAGGGAAAGCAAAAGGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ArsA_ATPase

Protein Analysis

356

Amino Acids

39.88

Weight (kDa)

4.78

Isoelectric Point (pI)

44.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ArsA_ATPase PF02374 21 - 312 9.1e-104 Anion-transporting ATPase
CbiA PF01656 23 - 223 4.5e-09 CobQ/CobB/MinD/ParA nucleotide binding domain
AAA_31 PF13614 27 - 146 2.4e-09 AAA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010938)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G01910 AT1G01910 AT1G01910 AT1G01910
fragaria_vesca FvH4_7g12910
malus_domestica MD02G1195500.v1.1 MD07G1125500.v1.1
prunus_persica Prupe.2G153000_v2.0.a1 Prupe.2G153000_v2.0.a1
pyrus_communis pycom02g15940 pycom07g11890
rosa_chinensis RchiOBHm_Chr1g0351991
rosa_laevigata RLG00000028370
rosa_multiflora Rmu_sc0007728.1_g000011
rosa_roxburghii Rroxscaffold_4G00303370
rosa_rugosa Rorug01G0223300
rosa_samantha Rh1BG207500 Rh1CG221700 Rh1DG234500
rosa_wichuraiana Rw1G020640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 541
AciI CCGC 3 cut(s) 78, 294, 519
AclI AACGTT 1 cut(s) 656
AclWI GGATC 4 cut(s) 118, 138, 260, 273
AcsI RAATTY 4 cut(s) 512, 563, 680, 728
AcuI CTGAAG 2 cut(s) 17, 915
AfaI GTAC 2 cut(s) 42, 768
AfiI CCNNNNNNNGG 3 cut(s) 63, 64, 1005
AflIII ACRYGT 1 cut(s) 849
AgsI TTSAA 4 cut(s) 392, 505, 637, 1018
AhdI GACNNNNNGTC 1 cut(s) 790
AjiI CACGTC 1 cut(s) 105
AjnI CCWGG 1 cut(s) 343
AluBI AGCT 7 cut(s) 111, 328, 366, 592, 880, 917, 1036
AluI AGCT 7 cut(s) 111, 328, 366, 592, 880, 917, 1036
Alw26I GTCTC 4 cut(s) 47, 488, 693, 700
AlwI GGATC 4 cut(s) 118, 138, 260, 273
AlwNI CAGNNNCTG 1 cut(s) 11
AoxI GGCC 2 cut(s) 357, 1065
ApeKI GCWGC 4 cut(s) 5, 108, 889, 1009
ApoI RAATTY 4 cut(s) 512, 563, 680, 728
ArsI GACNNNNNNTTYG 4 cut(s) 208, 240, 482, 514
AspLEI GCGC 1 cut(s) 543
AsuHPI GGTGA 2 cut(s) 202, 715
AsuNHI GCTAGC 1 cut(s) 328
BaeI ACNNNNGTAYC 2 cut(s) 815, 848
BamHI GGATCC 1 cut(s) 265
BbsI GAAGAC 3 cut(s) 61, 291, 789
BbvI GCAGC 4 cut(s) 17, 120, 876, 1021
BccI CCATC 1 cut(s) 472
BciT130I CCWGG 1 cut(s) 345
BcoDI GTCTC 4 cut(s) 47, 488, 693, 700
BfaI CTAG 2 cut(s) 329, 1037
BisI GCNGC 5 cut(s) 6, 79, 109, 890, 1010
BlsI GCNGC 5 cut(s) 7, 80, 110, 891, 1011
BmcAI AGTACT 1 cut(s) 768
Bme1390I CCNGG 1 cut(s) 345
BmeRI GACNNNNNGTC 1 cut(s) 790
BmgBI CACGTC 1 cut(s) 105
BmiI GGNNCC 2 cut(s) 239, 267
BmrFI CCNGG 1 cut(s) 345
BmsI GCATC 2 cut(s) 181, 565
BmtI GCTAGC 1 cut(s) 332
BpiI GAAGAC 3 cut(s) 61, 291, 789
BpmI CTGGAG 2 cut(s) 65, 927
Bpu10I CCTNAGC 1 cut(s) 1004
BpuEI CTTGAG 2 cut(s) 44, 614
Bsa29I ATCGAT 1 cut(s) 122
BsaI GGTCTC 2 cut(s) 47, 488
BsaJI CCNNGG 2 cut(s) 255, 344
BsaXI ACNNNNNCTCC 2 cut(s) 202, 232
Bsc4I CCNNNNNNNGG 3 cut(s) 63, 64, 1005
Bse1I ACTGG 6 cut(s) 48, 135, 439, 714, 841, 910
Bse3DI GCAATG 1 cut(s) 884
BseBI CCWGG 1 cut(s) 345
BseCI ATCGAT 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 255, 344
BseGI GGATG 1 cut(s) 580
BseLI CCNNNNNNNGG 3 cut(s) 63, 64, 1005
BseMI GCAATG 1 cut(s) 884
BseMII CTCAG 1 cut(s) 199
BseNI ACTGG 6 cut(s) 48, 135, 439, 714, 841, 910
BseXI GCAGC 4 cut(s) 17, 120, 876, 1021
BsgI GTGCAG 3 cut(s) 127, 411, 734
Bsh1236I CGCG 1 cut(s) 541
BshFI GGCC 2 cut(s) 359, 1067
BshVI ATCGAT 1 cut(s) 122
BslFI GGGAC 1 cut(s) 40
BslI CCNNNNNNNGG 3 cut(s) 63, 64, 1005
BsmAI GTCTC 4 cut(s) 47, 488, 693, 700
BsmFI GGGAC 1 cut(s) 40
BsmI GAATGC 3 cut(s) 672, 819, 825
BsnI GGCC 2 cut(s) 359, 1067
Bso31I GGTCTC 2 cut(s) 47, 488
Bsp143I GATC 3 cut(s) 123, 143, 265
Bsp19I CCATGG 1 cut(s) 255
BspACI CCGC 3 cut(s) 78, 294, 519
BspANI GGCC 2 cut(s) 359, 1067
BspCNI CTCAG 1 cut(s) 198
BspDI ATCGAT 1 cut(s) 122
BspFNI CGCG 1 cut(s) 541
BspLI GGNNCC 2 cut(s) 239, 267
BspOI GCTAGC 1 cut(s) 332
BspPI GGATC 4 cut(s) 118, 138, 260, 273
BspTNI GGTCTC 2 cut(s) 47, 488
BsrDI GCAATG 1 cut(s) 884
BsrI ACTGG 6 cut(s) 48, 135, 439, 714, 841, 910
BssECI CCNNGG 2 cut(s) 255, 344
BssMI GATC 3 cut(s) 123, 143, 265
BssT1I CCWWGG 1 cut(s) 255
Bst2UI CCWGG 1 cut(s) 345
Bst4CI ACNGT 3 cut(s) 274, 951, 973
Bst6I CTCTTC 2 cut(s) 36, 891
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 3 cut(s) 185, 1004, 1046
BstDSI CCRYGG 1 cut(s) 255
BstF5I GGATG 1 cut(s) 580
BstFNI CGCG 1 cut(s) 541
BstHHI GCGC 1 cut(s) 543
BstKTI GATC 3 cut(s) 126, 146, 268
BstMAI GTCTC 4 cut(s) 47, 488, 693, 700
BstMBI GATC 3 cut(s) 123, 143, 265
BstMWI GCNNNNNNNGC 3 cut(s) 886, 923, 1009
BstNI CCWGG 1 cut(s) 345
BstNSI RCATGY 1 cut(s) 853
BstSCI CCNGG 1 cut(s) 343
BstUI CGCG 1 cut(s) 541
BstV1I GCAGC 4 cut(s) 17, 120, 876, 1021
BstV2I GAAGAC 3 cut(s) 61, 291, 789
BstX2I RGATCY 2 cut(s) 143, 265
BstXI CCANNNNNNTGG 2 cut(s) 262, 973
BstYI RGATCY 2 cut(s) 143, 265
Bsu15I ATCGAT 1 cut(s) 122
BsuRI GGCC 2 cut(s) 359, 1067
BsuTUI ATCGAT 1 cut(s) 122
BtgI CCRYGG 1 cut(s) 255
BtgZI GCGATG 1 cut(s) 204
BtrI CACGTC 1 cut(s) 105
BtsCI GGATG 1 cut(s) 580
BtsI GCAGTG 1 cut(s) 423
BtsIMutI CAGTG 2 cut(s) 142, 423
Cac8I GCNNGC 1 cut(s) 330
CaiI CAGNNNCTG 1 cut(s) 11
CfoI GCGC 1 cut(s) 543
ClaI ATCGAT 1 cut(s) 122
CseI GACGC 1 cut(s) 547
Csp6I GTAC 2 cut(s) 41, 767
CviAII CATG 6 cut(s) 256, 281, 361, 601, 850, 933
CviQI GTAC 2 cut(s) 41, 767
DdeI CTNAG 3 cut(s) 185, 1004, 1046
DpnI GATC 3 cut(s) 125, 145, 267
DpnII GATC 3 cut(s) 123, 143, 265
DriI GACNNNNNGTC 1 cut(s) 790
Eam1104I CTCTTC 2 cut(s) 36, 891
Eam1105I GACNNNNNGTC 1 cut(s) 790
EarI CTCTTC 2 cut(s) 36, 891
EciI GGCGGA 1 cut(s) 309
Eco130I CCWWGG 1 cut(s) 255
Eco147I AGGCCT 1 cut(s) 1067
Eco31I GGTCTC 2 cut(s) 47, 488
Eco57I CTGAAG 2 cut(s) 17, 915
EcoRI GAATTC 1 cut(s) 680
EcoRII CCWGG 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 255
ErhI CCWWGG 1 cut(s) 255
FaeI CATG 6 cut(s) 259, 284, 364, 604, 853, 936
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FaqI GGGAC 1 cut(s) 40
FatI CATG 6 cut(s) 255, 280, 360, 600, 849, 932
Fnu4HI GCNGC 5 cut(s) 6, 79, 109, 890, 1010
FokI GGATG 1 cut(s) 587
Fsp4HI GCNGC 5 cut(s) 6, 79, 109, 890, 1010
FspBI CTAG 2 cut(s) 329, 1037
GlaI GCGC 1 cut(s) 542
GluI GCNGC 5 cut(s) 6, 79, 109, 890, 1010
GsuI CTGGAG 2 cut(s) 65, 927
HaeIII GGCC 2 cut(s) 359, 1067
HgaI GACGC 1 cut(s) 547
HhaI GCGC 1 cut(s) 543
Hin1II CATG 6 cut(s) 259, 284, 364, 604, 853, 936
Hin6I GCGC 1 cut(s) 541
HinP1I GCGC 1 cut(s) 541
HindIII AAGCTT 1 cut(s) 590
HinfI GANTC 5 cut(s) 28, 217, 529, 785, 977
HphI GGTGA 2 cut(s) 202, 715
Hpy166II GTNNAC 2 cut(s) 210, 999
Hpy188I TCNGA 6 cut(s) 13, 36, 325, 534, 921, 945
Hpy188III TCNNGA 2 cut(s) 677, 836
Hpy8I GTNNAC 2 cut(s) 210, 999
Hpy99I CGWCG 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 137, 969
HpyCH4III ACNGT 3 cut(s) 274, 951, 973
HpyCH4IV ACGT 3 cut(s) 39, 104, 656
HpyCH4V TGCA 7 cut(s) 108, 371, 428, 457, 672, 715, 823
HpyF10VI GCNNNNNNNGC 3 cut(s) 886, 923, 1009
HpyF3I CTNAG 3 cut(s) 185, 1004, 1046
HpySE526I ACGT 3 cut(s) 39, 104, 656
Hsp92II CATG 6 cut(s) 259, 284, 364, 604, 853, 936
HspAI GCGC 1 cut(s) 541
Kzo9I GATC 3 cut(s) 123, 143, 265
LmnI GCTCC 3 cut(s) 46, 325, 885
Lsp1109I GCAGC 4 cut(s) 17, 120, 876, 1021
LweI GCATC 2 cut(s) 181, 565
MaeI CTAG 2 cut(s) 329, 1037
MaeII ACGT 3 cut(s) 39, 104, 656
MaeIII GTNAC 1 cut(s) 901
MalI GATC 3 cut(s) 125, 145, 267
MboI GATC 3 cut(s) 123, 143, 265
MboII GAAGA 6 cut(s) 23, 61, 296, 791, 794, 908
MflI RGATCY 2 cut(s) 143, 265
MluCI AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
MlyI GAGTC 4 cut(s) 22, 211, 538, 779
MnlI CCTC 9 cut(s) 16, 19, 68, 157, 349, 554, 565, 589, 892
MseI TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
MslI CAYNNNNRTG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 345
Mva1269I GAATGC 3 cut(s) 672, 819, 825
MvaI CCWGG 1 cut(s) 345
MvnI CGCG 1 cut(s) 541
MwoI GCNNNNNNNGC 3 cut(s) 886, 923, 1009
NcoI CCATGG 1 cut(s) 255
NdeII GATC 3 cut(s) 123, 143, 265
NheI GCTAGC 1 cut(s) 328
NlaIII CATG 6 cut(s) 259, 284, 364, 604, 853, 936
NlaIV GGNNCC 2 cut(s) 239, 267
NspI RCATGY 1 cut(s) 853
PceI AGGCCT 1 cut(s) 1067
PciI ACATGT 1 cut(s) 849
PcsI WCGNNNNNNNCGW 1 cut(s) 977
PctI GAATGC 3 cut(s) 672, 819, 825
PfeI GAWTC 1 cut(s) 977
PkrI GCNGC 5 cut(s) 7, 80, 110, 891, 1011
PleI GAGTC 4 cut(s) 22, 211, 537, 779
PpsI GAGTC 4 cut(s) 22, 211, 537, 779
PscI ACATGT 1 cut(s) 849
Psp1406I AACGTT 1 cut(s) 656
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspN4I GGNNCC 2 cut(s) 239, 267
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 143, 265
RsaI GTAC 2 cut(s) 42, 768
RsaNI GTAC 2 cut(s) 41, 767
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
SatI GCNGC 5 cut(s) 6, 79, 109, 890, 1010
Sau3AI GATC 3 cut(s) 123, 143, 265
ScaI AGTACT 1 cut(s) 768
SchI GAGTC 4 cut(s) 22, 211, 538, 779
ScrFI CCNGG 1 cut(s) 345
SfaNI GCATC 2 cut(s) 181, 565
SmiMI CAYNNNNRTG 1 cut(s) 260
SmlI CTYRAG 2 cut(s) 59, 593
SmoI CTYRAG 2 cut(s) 59, 593
Sse9I AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
SseBI AGGCCT 1 cut(s) 1067
SsiI CCGC 3 cut(s) 78, 294, 519
SspI AATATT 1 cut(s) 751
SspMI CTAG 2 cut(s) 329, 1037
StuI AGGCCT 1 cut(s) 1067
StyD4I CCNGG 1 cut(s) 343
StyI CCWWGG 1 cut(s) 255
TaaI ACNGT 3 cut(s) 274, 951, 973
TaiI ACGT 3 cut(s) 42, 107, 659
TaqI TCGA 1 cut(s) 122
TasI AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
TatI WGTACW 1 cut(s) 766
TauI GCSGC 1 cut(s) 81
TfiI GAWTC 1 cut(s) 977
Tru1I TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
Tru9I TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
TscAI CASTG 2 cut(s) 142, 430
TseI GCWGC 4 cut(s) 5, 108, 889, 1009
TspDTI ATGAA 5 cut(s) 297, 617, 711, 792, 921
TspRI CASTG 2 cut(s) 142, 430
XapI RAATTY 4 cut(s) 512, 563, 680, 728
XceI RCATGY 1 cut(s) 853
XcmI CCANNNNNNNNNTGG 1 cut(s) 970
XspI CTAG 2 cut(s) 329, 1037
ZrmI AGTACT 1 cut(s) 768
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.