Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0017901

Physical Location & Seq

Genomic Coordinates Forward (+)

56975563 .. 56976288

Gene Structure 726 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGAATGCAATAGACTGTGCTTCTAGCCTGAAAATGTTCATTTGCAGAAATGCTGTGATGATTGATGATCACCAACTGGGCATAATAGCCAATGTTCTTGGCATGTTCATATTTCTCCTGGTGATTGCTTATCATTACGTGACGGCAGACCCAAAATATGAAGGCCACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ost4

Protein Analysis

56

Amino Acids

6.29

Weight (kDa)

5.73

Isoelectric Point (pI)

23.92

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ost4	PF10215	20 - 52	9.6e-15	Oligosaccaryltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017901)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12587
malus_domestica	MD01G1125600.v1.1 MD07G1195100.v1.1 MD07G1195400.v1.1
prunus_persica	Prupe.2G232600_v2.0.a1 Prupe.2G232600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0366451
rosa_multiflora	Rmu_ssc0000250.1_g000017
rosa_roxburghii	Rroxscaffold_4G00289930 Rroxscaffold_4G00290190
rosa_samantha	Rh1DG331100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AjnI	CCWGG	1 cut(s)	117
AoxI	GGCC	1 cut(s)	163
Asp700I	GAANNNNTTC	1 cut(s)	35
AsuHPI	GGTGA	2 cut(s)	62, 133
BceAI	ACGGC	1 cut(s)	159
BciT130I	CCWGG	1 cut(s)	119
BclI	TGATCA	1 cut(s)	67
BfaI	CTAG	1 cut(s)	24
Bme1390I	CCNGG	1 cut(s)	119
BmrFI	CCNGG	1 cut(s)	119
BmrI	ACTGGG	1 cut(s)	86
BmuI	ACTGGG	1 cut(s)	86
BsaAI	YACGTR	1 cut(s)	139
Bse1I	ACTGG	1 cut(s)	81
BseBI	CCWGG	1 cut(s)	119
BseNI	ACTGG	1 cut(s)	81
BshFI	GGCC	1 cut(s)	165
BsmI	GAATGC	1 cut(s)	10
BsnI	GGCC	1 cut(s)	165
Bsp143I	GATC	1 cut(s)	67
BspANI	GGCC	1 cut(s)	165
BsrI	ACTGG	1 cut(s)	81
BssMI	GATC	1 cut(s)	67
Bst2UI	CCWGG	1 cut(s)	119
Bst4CI	ACNGT	1 cut(s)	17
BstBAI	YACGTR	1 cut(s)	139
BstKTI	GATC	1 cut(s)	70
BstMBI	GATC	1 cut(s)	67
BstNI	CCWGG	1 cut(s)	119
BstNSI	RCATGY	1 cut(s)	106
BstSCI	CCNGG	1 cut(s)	117
BsuRI	GGCC	1 cut(s)	165
BtsIMutI	CAGTG	1 cut(s)	166
CviAII	CATG	1 cut(s)	103
CviJI	RGCY	3 cut(s)	27, 89, 165
CviKI_1	RGCY	3 cut(s)	27, 89, 165
DpnI	GATC	1 cut(s)	69
DpnII	GATC	1 cut(s)	67
EcoRII	CCWGG	1 cut(s)	117
FaeI	CATG	1 cut(s)	106
FaiI	YATR	4 cut(s)	83, 104, 110, 159
FatI	CATG	1 cut(s)	102
FbaI	TGATCA	1 cut(s)	67
FspBI	CTAG	1 cut(s)	24
HaeIII	GGCC	1 cut(s)	165
Hin1II	CATG	1 cut(s)	106
HphI	GGTGA	2 cut(s)	62, 133
HpyAV	CCTTC	1 cut(s)	155
HpyCH4III	ACNGT	1 cut(s)	17
HpyCH4IV	ACGT	1 cut(s)	138
HpyCH4V	TGCA	2 cut(s)	8, 45
HpySE526I	ACGT	1 cut(s)	138
Hsp92II	CATG	1 cut(s)	106
Ksp22I	TGATCA	1 cut(s)	67
Kzo9I	GATC	1 cut(s)	67
LpnPI	CCDG	4 cut(s)	41, 62, 104, 131
MaeI	CTAG	1 cut(s)	24
MaeII	ACGT	1 cut(s)	138
MaeIII	GTNAC	1 cut(s)	139
MalI	GATC	1 cut(s)	69
MboI	GATC	1 cut(s)	67
MroXI	GAANNNNTTC	1 cut(s)	35
MspR9I	CCNGG	1 cut(s)	119
Mva1269I	GAATGC	1 cut(s)	10
MvaI	CCWGG	1 cut(s)	119
NdeII	GATC	1 cut(s)	67
NlaIII	CATG	1 cut(s)	106
NmuCI	GTSAC	1 cut(s)	139
NspI	RCATGY	1 cut(s)	106
PctI	GAATGC	1 cut(s)	10
PdmI	GAANNNNTTC	1 cut(s)	35
Ppu21I	YACGTR	1 cut(s)	139
Psp6I	CCWGG	1 cut(s)	117
PspGI	CCWGG	1 cut(s)	117
Sau3AI	GATC	1 cut(s)	67
ScrFI	CCNGG	1 cut(s)	119
SetI	ASST	1 cut(s)	141
SgeI	CNNG	8 cut(s)	36, 40, 89, 110, 115, 130, 131, 151
SspMI	CTAG	1 cut(s)	24
StyD4I	CCNGG	1 cut(s)	117
TaaI	ACNGT	1 cut(s)	17
TaiI	ACGT	1 cut(s)	141
TseFI	GTSAC	1 cut(s)	139
Tsp45I	GTSAC	1 cut(s)	139
TspDTI	ATGAA	3 cut(s)	17, 28, 97
XceI	RCATGY	1 cut(s)	106
XmnI	GAANNNNTTC	1 cut(s)	35
XspI	CTAG	1 cut(s)	24

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.