RCHIOBHM_CHR0C39G0503321

receptor-like protein

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGCCTGATAACAAGTTGGAAGGTTCAATTCCGTCATTCAGTGGGGCCAAGAATGTTCACACCATAGAACTTTCCAACAATCGTCTAACAGGTACTATTAATTCCACCCACTGGAGAAACCTTACTAAGCTATCCTCTCTCTGTTTGAATTCCAATAAGCTCGATGGAAATATCCCAGCATCTCTGTTTTCTCTTCCCAGAATTGATCTTTCCAACAATCAATTCTCTGGTCCATTCCTGAAATTTCTAATGTGTCCTCCTCCTTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.77

Weight (kDa)

9.02

Isoelectric Point (pI)

37.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 111
AcsI RAATTY 2 cut(s) 148, 242
AfaI GTAC 1 cut(s) 94
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 2 cut(s) 27, 148
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
AluBI AGCT 2 cut(s) 130, 160
AluI AGCT 2 cut(s) 130, 160
AoxI GGCC 1 cut(s) 45
ApoI RAATTY 2 cut(s) 148, 242
AseI ATTAAT 1 cut(s) 99
AspS9I GGNCC 2 cut(s) 45, 230
AvaII GGWCC 1 cut(s) 230
BccI CCATC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 2 cut(s) 45, 230
BmiI GGNNCC 1 cut(s) 46
BmsI GCATC 1 cut(s) 188
BpmI CTGGAG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 116
BseLI CCNNNNNNNGG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 249
BseYI CCCAGC 1 cut(s) 175
BshFI GGCC 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 111
BsnI GGCC 1 cut(s) 47
Bsp143I GATC 1 cut(s) 205
BspANI GGCC 1 cut(s) 47
BspLI GGNNCC 1 cut(s) 46
BsrI ACTGG 1 cut(s) 116
BssMI GATC 1 cut(s) 205
Bst6I CTCTTC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 126
BstKTI GATC 1 cut(s) 208
BstMBI GATC 1 cut(s) 205
BsuRI GGCC 1 cut(s) 47
BtsIMutI CAGTG 2 cut(s) 46, 109
Cfr13I GGNCC 2 cut(s) 45, 230
Csp6I GTAC 1 cut(s) 93
CviJI RGCY 3 cut(s) 47, 130, 160
CviKI_1 RGCY 3 cut(s) 47, 130, 160
CviQI GTAC 1 cut(s) 93
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
Eco47I GGWCC 1 cut(s) 230
EcoRI GAATTC 1 cut(s) 148
FaiI YATR 1 cut(s) 65
GsaI CCCAGC 1 cut(s) 179
GsuI CTGGAG 1 cut(s) 133
HaeIII GGCC 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 238
Hpy8I GTNNAC 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 14
HpyF3I CTNAG 1 cut(s) 126
Kzo9I GATC 1 cut(s) 205
LpnPI CCDG 7 cut(s) 18, 75, 97, 189, 211, 213, 251
LweI GCATC 1 cut(s) 188
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MboII GAAGA 1 cut(s) 185
MluCI AATT 6 cut(s) 27, 100, 148, 201, 221, 242
MmeI TCCRAC 2 cut(s) 99, 237
MnlI CCTC 3 cut(s) 145, 267, 270
MseI TTAA 1 cut(s) 99
NdeII GATC 1 cut(s) 205
NlaIV GGNNCC 1 cut(s) 46
PflMI CCANNNNNTGG 1 cut(s) 111
PshBI ATTAAT 1 cut(s) 99
PspFI CCCAGC 1 cut(s) 175
PspN4I GGNNCC 1 cut(s) 46
PspPI GGNCC 2 cut(s) 45, 230
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 205
Sau96I GGNCC 2 cut(s) 45, 230
SetI ASST 5 cut(s) 25, 94, 123, 132, 162
SfaNI GCATC 1 cut(s) 188
SinI GGWCC 1 cut(s) 230
Sse9I AATT 6 cut(s) 27, 100, 148, 201, 221, 242
TaqI TCGA 1 cut(s) 162
TasI AATT 6 cut(s) 27, 100, 148, 201, 221, 242
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 2 cut(s) 46, 116
TspGWI ACGGA 1 cut(s) 21
TspRI CASTG 2 cut(s) 46, 116
Van91I CCANNNNNTGG 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 230
VspI ATTAAT 1 cut(s) 99
XapI RAATTY 2 cut(s) 148, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.