Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001207.1

Orthogroup ID

OG0018507

Physical Location & Seq

Genomic Coordinates Forward (+)

242149 .. 243096

Gene Structure 948 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001207.1_g000065.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 843 bp

atgaaaactttgctatctgatctcagtttgggatccaacaagctcgatgggaatatcccagcatctctgttttctcttctcccgttgggtcgtctagttatttccagcaatcaattctctggtccattcgctgaaatttcaaatgcgtcttccaacttgctttatggtcttgatttgagtagcaacaatctagaagggccaatacctatgtctatctttagcttgcaaggtcttatcaatctagatctttcttcaaataatttaagtggttcgtttcctctcgactgtctacaccaactgagaaatctttctttgagaacaattcctaatttcttgagaaatcagtcagtgattaatttggacctttcagagaaccagataagtagcatacccaaatggatttggagtttaaataatctcgaatccctacatctttcttggaactctctagataatctagaagttcggtctgtcaatcccactactctggtgatcatcttgattgacttctcgtgcaacaagttcaaaggatcaatacgaaaggaaattggagaactcatatcattagagaccctcaacttgtccaacaatgctttcacaggtgcagttccatcatcactaagttacttgagtcagctaaattcgttggacctctcgagaaacaaactgagcggtcaaatcccaccggaggttacaaatctcacttaccttgcattcctgaatctctcatataatcgattggtcgggaggataccaaacggtgctcaattttcaacatttgatgcagcttctttcgaaggtaacaaaggattatggggacctcctttaccagcagataagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0048507 GO:0048856

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

280

Amino Acids

30.58

Weight (kDa)

5.41

Isoelectric Point (pI)

35.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018507)

Species	Orthologous Gene IDs
malus_domestica	MD12G1153100.v1.1
rosa_chinensis	RchiOBHm_Chr0c39g0503321 RchiOBHm_Chr1g0353361
rosa_multiflora	Rmu_sc0001207.1_g000023 Rmu_sc0001207.1_g000065
rosa_rugosa	Rorug01G0234500 Rorug01G0234600 Rorug01G0234700 Rorug01G0234800
rosa_samantha	Rh3CG121600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	672
AccI	GTMKAC	1 cut(s)	289
AciI	CCGC	1 cut(s)	672
AclWI	GGATC	3 cut(s)	27, 40, 538
AcsI	RAATTY	2 cut(s)	135, 640
AfiI	CCNNNNNNNGG	1 cut(s)	688
AgsI	TTSAA	4 cut(s)	141, 255, 526, 774
AjuI	GAANNNNNNNTTGG	2 cut(s)	578, 610
AluBI	AGCT	4 cut(s)	43, 222, 637, 788
AluI	AGCT	4 cut(s)	43, 222, 637, 788
Alw21I	GWGCWC	1 cut(s)	766
Alw26I	GTCTC	1 cut(s)	563
AlwI	GGATC	3 cut(s)	27, 40, 538
Ama87I	CYCGRG	1 cut(s)	655
AoxI	GGCC	1 cut(s)	197
ApeKI	GCWGC	1 cut(s)	785
ApoI	RAATTY	2 cut(s)	135, 640
AseI	ATTAAT	1 cut(s)	354
Asp700I	GAANNNNTTC	1 cut(s)	307
AspS9I	GGNCC	5 cut(s)	122, 197, 361, 649, 818
AsuHPI	GGTGA	1 cut(s)	502
AsuII	TTCGAA	1 cut(s)	795
AvaI	CYCGRG	1 cut(s)	655
AvaII	GGWCC	4 cut(s)	122, 361, 649, 818
BamHI	GGATCC	1 cut(s)	32
BarI	GAAGNNNNNNTAC	2 cut(s)	186, 218
BauI	CACGAG	1 cut(s)	511
BbsI	GAAGAC	1 cut(s)	141
Bbv12I	GWGCWC	1 cut(s)	766
BbvI	GCAGC	1 cut(s)	797
BccI	CCATC	2 cut(s)	41, 619
BciVI	GTATCC	1 cut(s)	744
BclI	TGATCA	1 cut(s)	492
BcoDI	GTCTC	1 cut(s)	563
BfaI	CTAG	5 cut(s)	95, 191, 242, 449, 458
BfuI	GTATCC	1 cut(s)	744
BglII	AGATCT	1 cut(s)	244
BisI	GCNGC	1 cut(s)	786
BlsI	GCNGC	1 cut(s)	787
Bme18I	GGWCC	4 cut(s)	122, 361, 649, 818
BmeT110I	CYCGRG	1 cut(s)	655
BmgT120I	GGNCC	5 cut(s)	122, 197, 361, 649, 818
BmiI	GGNNCC	2 cut(s)	34, 819
BmsI	GCATC	2 cut(s)	71, 772
BpiI	GAAGAC	1 cut(s)	141
Bpu14I	TTCGAA	1 cut(s)	795
BpuEI	CTTGAG	2 cut(s)	355, 649
Bsa29I	ATCGAT	1 cut(s)	736
BsaI	GGTCTC	1 cut(s)	563
BsaWI	WCCGGW	1 cut(s)	685
Bsc4I	CCNNNNNNNGG	1 cut(s)	688
BseCI	ATCGAT	1 cut(s)	736
BseLI	CCNNNNNNNGG	1 cut(s)	688
BseMII	CTCAG	3 cut(s)	37, 290, 659
BseXI	GCAGC	1 cut(s)	797
BseYI	CCCAGC	1 cut(s)	58
BsgI	GTGCAG	1 cut(s)	624
BshFI	GGCC	1 cut(s)	199
BshVI	ATCGAT	1 cut(s)	736
BsiHKAI	GWGCWC	1 cut(s)	766
BsiHKCI	CYCGRG	1 cut(s)	655
BsiSI	CCGG	1 cut(s)	686
BslFI	GGGAC	1 cut(s)	831
BslI	CCNNNNNNNGG	1 cut(s)	688
BsmAI	GTCTC	1 cut(s)	563
BsmFI	GGGAC	1 cut(s)	831
BsmI	GAATGC	1 cut(s)	713
BsnI	GGCC	1 cut(s)	199
Bso31I	GGTCTC	1 cut(s)	563
BsoBI	CYCGRG	1 cut(s)	655
Bsp119I	TTCGAA	1 cut(s)	795
Bsp1286I	GDGCHC	1 cut(s)	766
Bsp143I	GATC	5 cut(s)	19, 32, 244, 492, 530
BspACI	CCGC	1 cut(s)	672
BspANI	GGCC	1 cut(s)	199
BspCNI	CTCAG	3 cut(s)	36, 291, 660
BspDI	ATCGAT	1 cut(s)	736
BspLI	GGNNCC	2 cut(s)	34, 819
BspPI	GGATC	3 cut(s)	27, 40, 538
BspT104I	TTCGAA	1 cut(s)	795
BspTNI	GGTCTC	1 cut(s)	563
BsrBI	CCGCTC	1 cut(s)	672
BssMI	GATC	5 cut(s)	19, 32, 244, 492, 530
BssSI	CACGAG	1 cut(s)	511
Bst2BI	CACGAG	1 cut(s)	511
Bst4CI	ACNGT	2 cut(s)	287, 761
Bst6I	CTCTTC	1 cut(s)	81
BstBI	TTCGAA	1 cut(s)	795
BstC8I	GCNNGC	1 cut(s)	224
BstDEI	CTNAG	4 cut(s)	23, 299, 620, 668
BstKTI	GATC	5 cut(s)	22, 35, 247, 495, 533
BstMAI	GTCTC	1 cut(s)	563
BstMBI	GATC	5 cut(s)	19, 32, 244, 492, 530
BstV1I	GCAGC	1 cut(s)	797
BstV2I	GAAGAC	1 cut(s)	141
BstX2I	RGATCY	2 cut(s)	32, 244
BstXI	CCANNNNNNTGG	1 cut(s)	487
BstYI	RGATCY	2 cut(s)	32, 244
Bsu15I	ATCGAT	1 cut(s)	736
BsuI	GTATCC	1 cut(s)	744
BsuRI	GGCC	1 cut(s)	199
BsuTUI	ATCGAT	1 cut(s)	736
BtsIMutI	CAGTG	1 cut(s)	354
Cac8I	GCNNGC	1 cut(s)	224
Cfr13I	GGNCC	5 cut(s)	122, 197, 361, 649, 818
ClaI	ATCGAT	1 cut(s)	736
CseI	GACGC	1 cut(s)	135
CviJI	RGCY	5 cut(s)	43, 199, 222, 637, 788
CviKI_1	RGCY	5 cut(s)	43, 199, 222, 637, 788
DdeI	CTNAG	4 cut(s)	23, 299, 620, 668
DpnI	GATC	5 cut(s)	21, 34, 246, 494, 532
DpnII	GATC	5 cut(s)	19, 32, 244, 492, 530
DraI	TTTAAA	1 cut(s)	411
Eam1104I	CTCTTC	1 cut(s)	81
EarI	CTCTTC	1 cut(s)	81
Eco31I	GGTCTC	1 cut(s)	563
Eco47I	GGWCC	4 cut(s)	122, 361, 649, 818
Eco88I	CYCGRG	1 cut(s)	655
EcoO109I	RGGNCCY	1 cut(s)	818
FaiI	YATR	7 cut(s)	165, 209, 389, 560, 730, 732, 814
FaqI	GGGAC	1 cut(s)	831
FbaI	TGATCA	1 cut(s)	492
FblI	GTMKAC	1 cut(s)	289
Fnu4HI	GCNGC	1 cut(s)	786
Fsp4HI	GCNGC	1 cut(s)	786
FspBI	CTAG	5 cut(s)	95, 191, 242, 449, 458
GluI	GCNGC	1 cut(s)	786
GsaI	CCCAGC	1 cut(s)	62
HaeIII	GGCC	1 cut(s)	199
HapII	CCGG	1 cut(s)	686
HgaI	GACGC	1 cut(s)	135
HinfI	GANTC	3 cut(s)	422, 631, 721
HpaII	CCGG	1 cut(s)	686
HphI	GGTGA	1 cut(s)	502
Hpy166II	GTNNAC	1 cut(s)	290
Hpy188I	TCNGA	2 cut(s)	19, 370
Hpy8I	GTNNAC	1 cut(s)	290
HpyAV	CCTTC	2 cut(s)	188, 791
HpyCH4III	ACNGT	2 cut(s)	287, 761
HpyCH4V	TGCA	5 cut(s)	226, 516, 605, 713, 785
HpyF3I	CTNAG	4 cut(s)	23, 299, 620, 668
Ksp22I	TGATCA	1 cut(s)	492
Kzo9I	GATC	5 cut(s)	19, 32, 244, 492, 530
LpnPI	CCDG	8 cut(s)	72, 105, 118, 389, 473, 585, 699, 731
Lsp1109I	GCAGC	1 cut(s)	797
LweI	GCATC	2 cut(s)	71, 772
MaeI	CTAG	5 cut(s)	95, 191, 242, 449, 458
MaeIII	GTNAC	3 cut(s)	623, 691, 800
MalI	GATC	5 cut(s)	21, 34, 246, 494, 532
MbiI	CCGCTC	1 cut(s)	672
MboI	GATC	5 cut(s)	19, 32, 244, 492, 530
MboII	GAAGA	3 cut(s)	68, 141, 243
MflI	RGATCY	2 cut(s)	32, 244
MhlI	GDGCHC	1 cut(s)	766
MluCI	AATT	9 cut(s)	113, 135, 259, 321, 328, 355, 546, 640, 767
MlyI	GAGTC	1 cut(s)	640
MmeI	TCCRAC	4 cut(s)	60, 177, 609, 627
MnlI	CCTC	6 cut(s)	288, 584, 662, 682, 741, 831
MroXI	GAANNNNTTC	1 cut(s)	307
MseI	TTAA	3 cut(s)	263, 354, 410
MspI	CCGG	1 cut(s)	686
Mva1269I	GAATGC	1 cut(s)	713
NdeII	GATC	5 cut(s)	19, 32, 244, 492, 530
NlaIV	GGNNCC	2 cut(s)	34, 819
NspV	TTCGAA	1 cut(s)	795
PaeR7I	CTCGAG	1 cut(s)	655
PctI	GAATGC	1 cut(s)	713
PdmI	GAANNNNTTC	1 cut(s)	307
PfeI	GAWTC	2 cut(s)	422, 721
PkrI	GCNGC	1 cut(s)	787
PleI	GAGTC	1 cut(s)	639
PpsI	GAGTC	1 cut(s)	639
PpuMI	RGGWCCY	1 cut(s)	818
PshBI	ATTAAT	1 cut(s)	354
Psp5II	RGGWCCY	1 cut(s)	818
PspFI	CCCAGC	1 cut(s)	58
PspN4I	GGNNCC	2 cut(s)	34, 819
PspPI	GGNCC	5 cut(s)	122, 197, 361, 649, 818
PspPPI	RGGWCCY	1 cut(s)	818
PsuI	RGATCY	2 cut(s)	32, 244
SaqAI	TTAA	3 cut(s)	263, 354, 410
SatI	GCNGC	1 cut(s)	786
Sau3AI	GATC	5 cut(s)	19, 32, 244, 492, 530
Sau96I	GGNCC	5 cut(s)	122, 197, 361, 649, 818
SchI	GAGTC	1 cut(s)	640
SduI	GDGCHC	1 cut(s)	766
SfaNI	GCATC	2 cut(s)	71, 772
Sfr274I	CTCGAG	1 cut(s)	655
SfuI	TTCGAA	1 cut(s)	795
SinI	GGWCC	4 cut(s)	122, 361, 649, 818
SlaI	CTCGAG	1 cut(s)	655
SmlI	CTYRAG	3 cut(s)	334, 628, 655
SmoI	CTYRAG	3 cut(s)	334, 628, 655
Sse9I	AATT	9 cut(s)	113, 135, 259, 321, 328, 355, 546, 640, 767
SsiI	CCGC	1 cut(s)	672
SspMI	CTAG	5 cut(s)	95, 191, 242, 449, 458
TaaI	ACNGT	2 cut(s)	287, 761
TaqI	TCGA	6 cut(s)	45, 282, 420, 656, 736, 795
TaqII	GACCGA	1 cut(s)	456
TasI	AATT	9 cut(s)	113, 135, 259, 321, 328, 355, 546, 640, 767
TfiI	GAWTC	2 cut(s)	422, 721
Tru1I	TTAA	3 cut(s)	263, 354, 410
Tru9I	TTAA	3 cut(s)	263, 354, 410
TscAI	CASTG	1 cut(s)	354
TseI	GCWGC	1 cut(s)	785
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	354
VpaK11BI	GGWCC	4 cut(s)	122, 361, 649, 818
VspI	ATTAAT	1 cut(s)	354
XapI	RAATTY	2 cut(s)	135, 640
XbaI	TCTAGA	4 cut(s)	190, 241, 448, 457
XhoI	CTCGAG	1 cut(s)	655
XmiI	GTMKAC	1 cut(s)	289
XmnI	GAANNNNTTC	1 cut(s)	307
XspI	CTAG	5 cut(s)	95, 191, 242, 449, 458

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.