RchiOBHm_Chr1g0338911

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
30109057 .. 30110536
1480 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56591

Sequence Viewer

Length: 159 bp
ATGGGATGCTTTCCAACTTGCACATGCTTTTTTAGGCTCTACTGTGTACAAAACAACCATGCTGTTCGTGCTAACTATGTCAAATGTATTTTTAAGAAATCTAAAGATGCTTACAAGGTGAGTCATTTGAAGAAATATTCAAAAACCAAAGAATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.12

Weight (kDa)

9.64

Isoelectric Point (pI)

15.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 48
AgsI TTSAA 2 cut(s) 130, 141
AsuHPI GGTGA 1 cut(s) 130
BmsI GCATC 1 cut(s) 97
BseGI GGATG 1 cut(s) 11
Bsp1407I TGTACA 1 cut(s) 46
BsrGI TGTACA 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 44
BstAUI TGTACA 1 cut(s) 46
BstF5I GGATG 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 27
BtsCI GGATG 1 cut(s) 11
Csp6I GTAC 1 cut(s) 47
CviAII CATG 2 cut(s) 24, 59
CviJI RGCY 1 cut(s) 37
CviKI_1 RGCY 1 cut(s) 37
CviQI GTAC 1 cut(s) 47
FaeI CATG 2 cut(s) 27, 62
FaiI YATR 4 cut(s) 25, 60, 78, 157
FatI CATG 2 cut(s) 23, 58
FokI GGATG 1 cut(s) 18
FspEI CC 4 cut(s) 19, 27, 71, 101
Hin1II CATG 2 cut(s) 27, 62
HinfI GANTC 2 cut(s) 121, 152
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 21
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
Hsp92II CATG 2 cut(s) 27, 62
LweI GCATC 1 cut(s) 97
MboII GAAGA 1 cut(s) 142
MlyI GAGTC 1 cut(s) 130
MmeI TCCRAC 1 cut(s) 38
MseI TTAA 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 68
NlaIII CATG 2 cut(s) 27, 62
NspI RCATGY 1 cut(s) 27
PfeI GAWTC 1 cut(s) 152
PleI GAGTC 1 cut(s) 129
PpsI GAGTC 1 cut(s) 129
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 93
SchI GAGTC 1 cut(s) 130
SetI ASST 1 cut(s) 120
SfaNI GCATC 1 cut(s) 97
SgeI CNNG 5 cut(s) 30, 36, 71, 80, 127
SspI AATATT 1 cut(s) 137
TaaI ACNGT 1 cut(s) 44
TatI WGTACW 1 cut(s) 46
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
XceI RCATGY 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.