RchiOBHm_Chr1g0359691

WAT1-related protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
51567323 .. 51569619
2297 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58472

Sequence Viewer

Length: 282 bp
ATGAATTGCCAAAGGTTTTTTCAATCAACTCAAACTGTTCCTGAGGGAGTTTTTGGGTCAGCTTTCCAGGTTGGTGTATCGACATGGTGTTTATGCTCAACCTTTGGGGATTATATTACAATTATCACCAGTGTTATCCAGCAGTCAAGTTTAGTTGAATTTTCTACTGTATATGGGTTCAAGCCTTTGGGAATTGTAGTTACAGTTGCCATTGGTTTTGCATTGAAACCTACTATTGCTCTTTTTCTCAGAAAATCCAGAAAGAAGGCACAGGCTATCTAG

Protein Analysis

93

Amino Acids

10.18

Weight (kDa)

9.51

Isoelectric Point (pI)

21.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 158
AgsI TTSAA 4 cut(s) 23, 158, 181, 226
AjnI CCWGG 1 cut(s) 66
AjuI GAANNNNNNNTTGG 1 cut(s) 35
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
ApoI RAATTY 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 118
AxyI CCTNAGG 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 68
BfaI CTAG 1 cut(s) 280
Bme1390I CCNGG 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 129
Bse21I CCTNAGG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 68
BseMII CTCAG 2 cut(s) 33, 262
BseNI ACTGG 1 cut(s) 129
BspCNI CTCAG 2 cut(s) 34, 261
BsrI ACTGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 3 cut(s) 37, 169, 205
BstDEI CTNAG 2 cut(s) 42, 248
BstNI CCWGG 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 66
Bsu36I CCTNAGG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 136
CviAII CATG 1 cut(s) 84
CviJI RGCY 3 cut(s) 62, 184, 275
CviKI_1 RGCY 3 cut(s) 62, 184, 275
DdeI CTNAG 2 cut(s) 42, 248
Eco81I CCTNAGG 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 66
FaeI CATG 1 cut(s) 87
FaiI YATR 5 cut(s) 85, 94, 114, 172, 174
FatI CATG 1 cut(s) 83
FspBI CTAG 1 cut(s) 280
Hin1II CATG 1 cut(s) 87
HphI GGTGA 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 251
Hpy188III TCNNGA 2 cut(s) 41, 258
HpyAV CCTTC 1 cut(s) 259
HpyCH4III ACNGT 3 cut(s) 37, 169, 205
HpyCH4V TGCA 1 cut(s) 221
HpyF3I CTNAG 2 cut(s) 42, 248
Hsp92II CATG 1 cut(s) 87
LpnPI CCDG 7 cut(s) 53, 54, 80, 142, 152, 257, 271
MaeI CTAG 1 cut(s) 280
MaeIII GTNAC 1 cut(s) 199
MluCI AATT 4 cut(s) 4, 120, 158, 192
MnlI CCTC 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
NlaIII CATG 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 68
SetI ASST 5 cut(s) 17, 64, 72, 104, 232
SgeI CNNG 9 cut(s) 53, 79, 80, 96, 141, 151, 159, 193, 270
Sse9I AATT 4 cut(s) 4, 120, 158, 192
SspMI CTAG 1 cut(s) 280
StyD4I CCNGG 1 cut(s) 66
TaaI ACNGT 3 cut(s) 37, 169, 205
TaqI TCGA 1 cut(s) 80
TasI AATT 4 cut(s) 4, 120, 158, 192
TscAI CASTG 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 136
XapI RAATTY 1 cut(s) 158
XspI CTAG 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.