RchiOBHm_Chr1g0384541

DnaJ molecular chaperone homology domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0013956
Physical Location & Seq
Reverse (-)
68329566 .. 68333071
3506 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60737

Sequence Viewer

Length: 342 bp
ATGGAGGGCAGTGGCAGTGATAATACCATCCCCAACCAAAACAAGAAGTGGCATCCTGATAAGCACAACGGTGGCAGTCACGTTACAGCAAAGTTTCAAGAGATTAACGAAGCTTACGAAGGTAACTCAGTCCTTTGGTTATTGGAAATGTTGAGTGATCCTGCTAAGCGACTTGACTATGATCTAACTGGCATATGTGAGATTGATAAGTATACTTTACCGGAATATCTTGGCAGATTTAGGGGAATGATACTTACATGCAATGGCCTGGGTATTAGTCATGCATCAACATGGTCACAACAATTGGTGGAAACTGATGGCTTAGCAGAGAAATCAGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

113

Amino Acids

12.58

Weight (kDa)

5.06

Isoelectric Point (pI)

26.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 14 - 61 8.5e-08 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G16650 AT5G16650
fragaria_vesca FvH4_7g34190 FvH4_7g34190 FvH4_7g34190
prunus_persica Prupe.2G328700_v2.0.a1 Prupe.2G328700_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0384541
rosa_laevigata RLG00000026033
rosa_roxburghii Rroxscaffold_4G00276610
rosa_rugosa Rorug01G0448800 Rorug01G0448900
rosa_samantha Rh1AG473900 Rh1BG432000 Rh1CG445100 Rh1DG464500
rosa_wichuraiana Rw1G039860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 212
AclWI GGATC 1 cut(s) 152
AgsI TTSAA 1 cut(s) 98
AjnI CCWGG 1 cut(s) 267
AleI CACNNNNGTG 1 cut(s) 69
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwI GGATC 1 cut(s) 152
AoxI GGCC 1 cut(s) 265
BccI CCATC 2 cut(s) 35, 311
BciT130I CCWGG 1 cut(s) 269
BlpI GCTNAGC 2 cut(s) 165, 322
Bme1390I CCNGG 1 cut(s) 269
BmrFI CCNGG 1 cut(s) 269
BmsI GCATC 2 cut(s) 61, 293
Bpu1102I GCTNAGC 2 cut(s) 165, 322
BsaJI CCNNGG 1 cut(s) 268
BsaWI WCCGGW 1 cut(s) 220
Bse1I ACTGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 268
BseBI CCWGG 1 cut(s) 269
BseDI CCNNGG 1 cut(s) 268
BseGI GGATG 2 cut(s) 27, 52
BseMI GCAATG 1 cut(s) 268
BseMII CTCAG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 193
BshFI GGCC 1 cut(s) 267
BsiSI CCGG 1 cut(s) 221
BsnI GGCC 1 cut(s) 267
Bsp143I GATC 2 cut(s) 157, 181
Bsp1720I GCTNAGC 2 cut(s) 165, 322
BspANI GGCC 1 cut(s) 267
BspCNI CTCAG 1 cut(s) 140
BspPI GGATC 1 cut(s) 152
BsrDI GCAATG 1 cut(s) 268
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 268
BssMI GATC 2 cut(s) 157, 181
BssNAI GTATAC 1 cut(s) 213
Bst1107I GTATAC 1 cut(s) 213
Bst2UI CCWGG 1 cut(s) 269
Bst4CI ACNGT 1 cut(s) 71
BstDEI CTNAG 3 cut(s) 127, 165, 322
BstF5I GGATG 2 cut(s) 27, 52
BstKTI GATC 2 cut(s) 160, 184
BstMBI GATC 2 cut(s) 157, 181
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 267
BstZ17I GTATAC 1 cut(s) 213
BsuRI GGCC 1 cut(s) 267
BtsCI GGATG 2 cut(s) 27, 52
BtsI GCAGTG 2 cut(s) 16, 22
BtsIMutI CAGTG 2 cut(s) 16, 22
CviAII CATG 3 cut(s) 258, 281, 291
CviJI RGCY 4 cut(s) 113, 267, 321, 338
CviKI_1 RGCY 4 cut(s) 113, 267, 321, 338
DdeI CTNAG 3 cut(s) 127, 165, 322
DpnI GATC 2 cut(s) 159, 183
DpnII GATC 2 cut(s) 157, 181
EcoRII CCWGG 1 cut(s) 267
EcoT22I ATGCAT 1 cut(s) 286
FaeI CATG 3 cut(s) 261, 284, 294
FaiI YATR 7 cut(s) 180, 194, 196, 213, 259, 282, 292
FatI CATG 3 cut(s) 257, 280, 290
FauNDI CATATG 1 cut(s) 194
FblI GTMKAC 1 cut(s) 212
FokI GGATG 2 cut(s) 14, 39
HaeIII GGCC 1 cut(s) 267
HapII CCGG 1 cut(s) 221
Hin1II CATG 3 cut(s) 261, 284, 294
HindIII AAGCTT 1 cut(s) 111
HpaII CCGG 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 213
Hpy188III TCNNGA 2 cut(s) 56, 98
Hpy8I GTNNAC 1 cut(s) 213
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 261, 284
HpyF3I CTNAG 3 cut(s) 127, 165, 322
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 3 cut(s) 261, 284, 294
Kzo9I GATC 2 cut(s) 157, 181
LpnPI CCDG 6 cut(s) 69, 174, 174, 234, 254, 281
LweI GCATC 2 cut(s) 61, 293
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 4 cut(s) 77, 82, 122, 294
MalI GATC 2 cut(s) 159, 183
MboI GATC 2 cut(s) 157, 181
MfeI CAATTG 1 cut(s) 302
MluCI AATT 1 cut(s) 302
Mph1103I ATGCAT 1 cut(s) 286
MseI TTAA 1 cut(s) 105
MslI CAYNNNNRTG 2 cut(s) 69, 289
MspI CCGG 1 cut(s) 221
MspR9I CCNGG 1 cut(s) 269
MunI CAATTG 1 cut(s) 302
MvaI CCWGG 1 cut(s) 269
NdeI CATATG 1 cut(s) 194
NdeII GATC 2 cut(s) 157, 181
NlaIII CATG 3 cut(s) 261, 284, 294
NmuCI GTSAC 2 cut(s) 77, 294
NsiI ATGCAT 1 cut(s) 286
NspI RCATGY 1 cut(s) 261
OliI CACNNNNGTG 1 cut(s) 69
PcsI WCGNNNNNNNCGW 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 267
PspGI CCWGG 1 cut(s) 267
RseI CAYNNNNRTG 2 cut(s) 69, 289
SaqAI TTAA 1 cut(s) 105
Sau3AI GATC 2 cut(s) 157, 181
ScrFI CCNGG 1 cut(s) 269
SetI ASST 3 cut(s) 84, 115, 124
SfaNI GCATC 2 cut(s) 61, 293
SmiMI CAYNNNNRTG 2 cut(s) 69, 289
Sse9I AATT 1 cut(s) 302
StyD4I CCNGG 1 cut(s) 267
TaaI ACNGT 1 cut(s) 71
TaiI ACGT 1 cut(s) 84
TasI AATT 1 cut(s) 302
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 2 cut(s) 16, 22
TseFI GTSAC 2 cut(s) 77, 294
Tsp45I GTSAC 2 cut(s) 77, 294
TspRI CASTG 2 cut(s) 16, 22
XceI RCATGY 1 cut(s) 261
XmiI GTMKAC 1 cut(s) 212
Zsp2I ATGCAT 1 cut(s) 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.