Rh1AG473900

DnaJ molecular chaperone homology domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0013956
Physical Location & Seq
Reverse (-)
68504200 .. 68505490
1291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG473900.1

Sequence Viewer

Length: 363 bp
ATGGGCCTTGCAACTTGTCCCAAGGATTACTACAAAATTTTGGAGGTTGATTATGATGCAACTGATGAGAACATCAAACTAAACTACCGAAGGCTTGCTCTGAAGTGGCATCCTGATAAGCACAACGGTGGCAGTCACGTTACAGCAAAGTTTCAAGAGATTAACGAAGCTTACGAAGTGTTGAGTGATCCTGCTAAGCGACTTGACTATGATCTAACTGAGATTGATAAGTATACTTTACCGGAATATCTTGGCAGATTTAGGGGAATGATACTTACATGCAATGGCCTGGGTATTAGTCATGCATCAACATGGTCACAACAATTGATGGAAACTGATGGCTTAGCTGAGAAATCAGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

120

Amino Acids

13.72

Weight (kDa)

5.29

Isoelectric Point (pI)

35.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 9 - 71 1.2e-25 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G16650 AT5G16650
fragaria_vesca FvH4_7g34190 FvH4_7g34190 FvH4_7g34190
prunus_persica Prupe.2G328700_v2.0.a1 Prupe.2G328700_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0384541
rosa_laevigata RLG00000026033
rosa_roxburghii Rroxscaffold_4G00276610
rosa_rugosa Rorug01G0448800 Rorug01G0448900
rosa_samantha Rh1AG473900 Rh1BG432000 Rh1CG445100 Rh1DG464500
rosa_wichuraiana Rw1G039860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 233
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 122
AgsI TTSAA 1 cut(s) 155
AjnI CCWGG 1 cut(s) 288
AleI CACNNNNGTG 1 cut(s) 126
AluBI AGCT 2 cut(s) 170, 347
AluI AGCT 2 cut(s) 170, 347
AlwI GGATC 1 cut(s) 182
AoxI GGCC 2 cut(s) 4, 286
ApoI RAATTY 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 4
BccI CCATC 2 cut(s) 322, 332
BciT130I CCWGG 1 cut(s) 290
BlpI GCTNAGC 2 cut(s) 195, 343
Bme1390I CCNGG 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 290
BmsI GCATC 3 cut(s) 46, 118, 314
Bpu1102I GCTNAGC 2 cut(s) 195, 343
BsaJI CCNNGG 2 cut(s) 21, 289
BsaWI WCCGGW 1 cut(s) 241
Bse3DI GCAATG 1 cut(s) 289
BseBI CCWGG 1 cut(s) 290
BseDI CCNNGG 2 cut(s) 21, 289
BseGI GGATG 1 cut(s) 109
BseMI GCAATG 1 cut(s) 289
BseMII CTCAG 2 cut(s) 210, 339
BshFI GGCC 2 cut(s) 6, 288
BsiSI CCGG 1 cut(s) 242
BslFI GGGAC 1 cut(s) 3
BsmFI GGGAC 1 cut(s) 3
BsnI GGCC 2 cut(s) 6, 288
Bsp143I GATC 2 cut(s) 187, 211
Bsp1720I GCTNAGC 2 cut(s) 195, 343
BspANI GGCC 2 cut(s) 6, 288
BspCNI CTCAG 2 cut(s) 211, 340
BspPI GGATC 1 cut(s) 182
BsrDI GCAATG 1 cut(s) 289
BssECI CCNNGG 2 cut(s) 21, 289
BssMI GATC 2 cut(s) 187, 211
BssNAI GTATAC 1 cut(s) 234
BssT1I CCWWGG 1 cut(s) 21
Bst1107I GTATAC 1 cut(s) 234
Bst2UI CCWGG 1 cut(s) 290
Bst4CI ACNGT 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 96
BstDEI CTNAG 4 cut(s) 195, 219, 343, 348
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 2 cut(s) 190, 214
BstMBI GATC 2 cut(s) 187, 211
BstNI CCWGG 1 cut(s) 290
BstNSI RCATGY 1 cut(s) 282
BstSCI CCNGG 1 cut(s) 288
BstZ17I GTATAC 1 cut(s) 234
BsuRI GGCC 2 cut(s) 6, 288
BtsCI GGATG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 3 cut(s) 279, 302, 312
CviJI RGCY 7 cut(s) 6, 94, 170, 288, 342, 347, 359
CviKI_1 RGCY 7 cut(s) 6, 94, 170, 288, 342, 347, 359
DdeI CTNAG 4 cut(s) 195, 219, 343, 348
DpnI GATC 2 cut(s) 189, 213
DpnII GATC 2 cut(s) 187, 211
Eco130I CCWWGG 1 cut(s) 21
Eco57I CTGAAG 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 288
EcoT14I CCWWGG 1 cut(s) 21
EcoT22I ATGCAT 1 cut(s) 307
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 3 cut(s) 282, 305, 315
FaiI YATR 6 cut(s) 54, 210, 234, 280, 303, 313
FaqI GGGAC 1 cut(s) 3
FatI CATG 3 cut(s) 278, 301, 311
FblI GTMKAC 1 cut(s) 233
FokI GGATG 1 cut(s) 96
HaeIII GGCC 2 cut(s) 6, 288
HapII CCGG 1 cut(s) 242
Hin1II CATG 3 cut(s) 282, 305, 315
HindIII AAGCTT 1 cut(s) 168
HpaII CCGG 1 cut(s) 242
Hpy166II GTNNAC 1 cut(s) 234
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 2 cut(s) 113, 155
Hpy8I GTNNAC 1 cut(s) 234
HpyAV CCTTC 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 128
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 4 cut(s) 11, 59, 282, 305
HpyF3I CTNAG 4 cut(s) 195, 219, 343, 348
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 3 cut(s) 282, 305, 315
Kzo9I GATC 2 cut(s) 187, 211
LpnPI CCDG 5 cut(s) 126, 204, 255, 275, 302
LweI GCATC 3 cut(s) 46, 118, 314
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 3 cut(s) 134, 139, 315
MalI GATC 2 cut(s) 189, 213
MboI GATC 2 cut(s) 187, 211
MfeI CAATTG 1 cut(s) 323
MluCI AATT 2 cut(s) 36, 323
MnlI CCTC 1 cut(s) 37
Mph1103I ATGCAT 1 cut(s) 307
MseI TTAA 1 cut(s) 162
MslI CAYNNNNRTG 2 cut(s) 126, 310
MspI CCGG 1 cut(s) 242
MspR9I CCNGG 1 cut(s) 290
MunI CAATTG 1 cut(s) 323
MvaI CCWGG 1 cut(s) 290
NdeII GATC 2 cut(s) 187, 211
NlaIII CATG 3 cut(s) 282, 305, 315
NmuCI GTSAC 2 cut(s) 134, 315
NsiI ATGCAT 1 cut(s) 307
NspI RCATGY 1 cut(s) 282
OliI CACNNNNGTG 1 cut(s) 126
PcsI WCGNNNNNNNCGW 1 cut(s) 171
Psp6I CCWGG 1 cut(s) 288
PspGI CCWGG 1 cut(s) 288
PspPI GGNCC 1 cut(s) 4
RseI CAYNNNNRTG 2 cut(s) 126, 310
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 2 cut(s) 187, 211
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 290
SetI ASST 4 cut(s) 48, 141, 172, 349
SfaNI GCATC 3 cut(s) 46, 118, 314
SmiMI CAYNNNNRTG 2 cut(s) 126, 310
Sse9I AATT 2 cut(s) 36, 323
StyD4I CCNGG 1 cut(s) 288
StyI CCWWGG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 128
TaiI ACGT 1 cut(s) 141
TasI AATT 2 cut(s) 36, 323
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseFI GTSAC 2 cut(s) 134, 315
Tsp45I GTSAC 2 cut(s) 134, 315
XapI RAATTY 1 cut(s) 36
XceI RCATGY 1 cut(s) 282
XmiI GTMKAC 1 cut(s) 233
Zsp2I ATGCAT 1 cut(s) 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.