Rw1G039860

DnaJ molecular chaperone homology domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0013956
Physical Location & Seq
Forward (+)
67400882 .. 67405426
4545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G039860.1

Sequence Viewer

Length: 429 bp
ATGGTCCAGTCGAAAGAAATACGAAAAGCCCAACGGCCCATTAGAATCTCTTTCCTCTGCCTGAATTTGCGAGGACACCGCACATATGATACAACAGCCGACAAGTCTTTCCCAATGGAGGGCAGTGGCAGTGATAATACCATCCCCAACCAAAACAAGAAGTGGCATCCTGATAAGCACAACGGTGGCAGTCACGTTACAGCAAAGTTTCAAGAGATTAACGAAGCTTACGAAGTGTTGAGTGATCCTGCTAAGCGACTTGACTATGATCTAACTGGCATATGTGAGATTGATAAGTATACTTTACCGGAATATCTTGGCAGATTTAGGGGAATGATACTTACATGCAATGGCCTGGGTATTAGTCATGCATCAACATGGTCACAACAATTGGTGGAAACTGATGGCTTAGCAGAGAAATCAGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

142

Amino Acids

16.0

Weight (kDa)

6.96

Isoelectric Point (pI)

29.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 52 - 90 3.7e-13 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G16650 AT5G16650
fragaria_vesca FvH4_7g34190 FvH4_7g34190 FvH4_7g34190
prunus_persica Prupe.2G328700_v2.0.a1 Prupe.2G328700_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0384541
rosa_laevigata RLG00000026033
rosa_roxburghii Rroxscaffold_4G00276610
rosa_rugosa Rorug01G0448800 Rorug01G0448900
rosa_samantha Rh1AG473900 Rh1BG432000 Rh1CG445100 Rh1DG464500
rosa_wichuraiana Rw1G039860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 299
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 239
AcsI RAATTY 1 cut(s) 64
AfiI CCNNNNNNNGG 2 cut(s) 118, 119
AgsI TTSAA 1 cut(s) 212
AjnI CCWGG 1 cut(s) 354
AleI CACNNNNGTG 1 cut(s) 183
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AlwI GGATC 1 cut(s) 239
AoxI GGCC 2 cut(s) 35, 352
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 2 cut(s) 4, 36
AvaII GGWCC 1 cut(s) 4
BccI CCATC 2 cut(s) 149, 398
BceAI ACGGC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 356
BlpI GCTNAGC 2 cut(s) 252, 409
Bme1390I CCNGG 1 cut(s) 356
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 36
BmrFI CCNGG 1 cut(s) 356
BmsI GCATC 2 cut(s) 175, 380
Bpu1102I GCTNAGC 2 cut(s) 252, 409
BsaJI CCNNGG 1 cut(s) 355
BsaWI WCCGGW 1 cut(s) 307
Bsc4I CCNNNNNNNGG 2 cut(s) 118, 119
Bse1I ACTGG 2 cut(s) 7, 280
Bse3DI GCAATG 1 cut(s) 355
BseBI CCWGG 1 cut(s) 356
BseDI CCNNGG 1 cut(s) 355
BseGI GGATG 2 cut(s) 141, 166
BseLI CCNNNNNNNGG 2 cut(s) 118, 119
BseMI GCAATG 1 cut(s) 355
BseNI ACTGG 2 cut(s) 7, 280
BshFI GGCC 2 cut(s) 37, 354
BsiSI CCGG 1 cut(s) 308
BslI CCNNNNNNNGG 2 cut(s) 118, 119
BsnI GGCC 2 cut(s) 37, 354
Bsp143I GATC 2 cut(s) 244, 268
Bsp1720I GCTNAGC 2 cut(s) 252, 409
BspACI CCGC 1 cut(s) 79
BspANI GGCC 2 cut(s) 37, 354
BspPI GGATC 1 cut(s) 239
BsrDI GCAATG 1 cut(s) 355
BsrI ACTGG 2 cut(s) 7, 280
BssECI CCNNGG 1 cut(s) 355
BssMI GATC 2 cut(s) 244, 268
BssNAI GTATAC 1 cut(s) 300
Bst1107I GTATAC 1 cut(s) 300
Bst2UI CCWGG 1 cut(s) 356
Bst4CI ACNGT 1 cut(s) 185
BstDEI CTNAG 2 cut(s) 252, 409
BstF5I GGATG 2 cut(s) 141, 166
BstKTI GATC 2 cut(s) 247, 271
BstMBI GATC 2 cut(s) 244, 268
BstNI CCWGG 1 cut(s) 356
BstNSI RCATGY 1 cut(s) 348
BstSCI CCNGG 1 cut(s) 354
BstZ17I GTATAC 1 cut(s) 300
BsuRI GGCC 2 cut(s) 37, 354
BtsCI GGATG 2 cut(s) 141, 166
BtsI GCAGTG 2 cut(s) 130, 136
BtsIMutI CAGTG 2 cut(s) 130, 136
Cfr13I GGNCC 2 cut(s) 4, 36
CviAII CATG 3 cut(s) 345, 368, 378
CviJI RGCY 7 cut(s) 29, 37, 98, 227, 354, 408, 425
CviKI_1 RGCY 7 cut(s) 29, 37, 98, 227, 354, 408, 425
DdeI CTNAG 2 cut(s) 252, 409
DpnI GATC 2 cut(s) 246, 270
DpnII GATC 2 cut(s) 244, 268
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 354
EcoT22I ATGCAT 1 cut(s) 373
FaeI CATG 3 cut(s) 348, 371, 381
FaiI YATR 9 cut(s) 85, 87, 267, 281, 283, 300, 346, 369, 379
FatI CATG 3 cut(s) 344, 367, 377
FauNDI CATATG 2 cut(s) 85, 281
FblI GTMKAC 1 cut(s) 299
FokI GGATG 2 cut(s) 128, 153
HaeIII GGCC 2 cut(s) 37, 354
HapII CCGG 1 cut(s) 308
Hin1II CATG 3 cut(s) 348, 371, 381
HindIII AAGCTT 1 cut(s) 225
HinfI GANTC 1 cut(s) 45
HpaII CCGG 1 cut(s) 308
Hpy166II GTNNAC 1 cut(s) 300
Hpy188III TCNNGA 2 cut(s) 170, 212
Hpy8I GTNNAC 1 cut(s) 300
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 2 cut(s) 348, 371
HpyF3I CTNAG 2 cut(s) 252, 409
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 3 cut(s) 348, 371, 381
Kzo9I GATC 2 cut(s) 244, 268
LpnPI CCDG 8 cut(s) 20, 74, 183, 261, 261, 321, 341, 368
LweI GCATC 2 cut(s) 175, 380
MaeII ACGT 1 cut(s) 195
MaeIII GTNAC 3 cut(s) 191, 196, 381
MalI GATC 2 cut(s) 246, 270
MboI GATC 2 cut(s) 244, 268
MfeI CAATTG 1 cut(s) 389
MluCI AATT 2 cut(s) 64, 389
MnlI CCTC 3 cut(s) 65, 65, 112
Mph1103I ATGCAT 1 cut(s) 373
MseI TTAA 1 cut(s) 219
MslI CAYNNNNRTG 2 cut(s) 183, 376
MspI CCGG 1 cut(s) 308
MspR9I CCNGG 1 cut(s) 356
MunI CAATTG 1 cut(s) 389
MvaI CCWGG 1 cut(s) 356
NdeI CATATG 2 cut(s) 85, 281
NdeII GATC 2 cut(s) 244, 268
NlaIII CATG 3 cut(s) 348, 371, 381
NmuCI GTSAC 2 cut(s) 191, 381
NsiI ATGCAT 1 cut(s) 373
NspI RCATGY 1 cut(s) 348
OliI CACNNNNGTG 1 cut(s) 183
PcsI WCGNNNNNNNCGW 1 cut(s) 228
PfeI GAWTC 1 cut(s) 45
Psp6I CCWGG 1 cut(s) 354
PspGI CCWGG 1 cut(s) 354
PspPI GGNCC 2 cut(s) 4, 36
RseI CAYNNNNRTG 2 cut(s) 183, 376
SaqAI TTAA 1 cut(s) 219
Sau3AI GATC 2 cut(s) 244, 268
Sau96I GGNCC 2 cut(s) 4, 36
ScrFI CCNGG 1 cut(s) 356
SetI ASST 2 cut(s) 198, 229
SfaNI GCATC 2 cut(s) 175, 380
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 2 cut(s) 183, 376
Sse9I AATT 2 cut(s) 64, 389
SsiI CCGC 1 cut(s) 79
StyD4I CCNGG 1 cut(s) 354
TaaI ACNGT 1 cut(s) 185
TaiI ACGT 1 cut(s) 198
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 64, 389
TfiI GAWTC 1 cut(s) 45
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 2 cut(s) 130, 136
TseFI GTSAC 2 cut(s) 191, 381
Tsp45I GTSAC 2 cut(s) 191, 381
TspRI CASTG 2 cut(s) 130, 136
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 64
XceI RCATGY 1 cut(s) 348
XmiI GTMKAC 1 cut(s) 299
Zsp2I ATGCAT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.