Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0016979

Physical Location & Seq

Genomic Coordinates Reverse (-)

20031898 .. 20034167

Gene Structure 2270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ48253

Sequence Viewer

CDS Protein Promoter (2k)

Length: 144 bp

ATGGCAAGATACATGTATCAGAAATATATGAGGGAGAAAATTCTGAGGTACAGAAGAGGCAAAGTCCATCATGATTCATCTAACAAGTCCCCAAATTGGCAAAGGGGGAACAGGAGGCTTACTAAAGAAACAGGTGAAATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001101 GO:0003006 GO:0006950 GO:0006970 GO:0006972 GO:0007275 GO:0008150 GO:0009266 GO:0009409 GO:0009414 GO:0009415 GO:0009555 GO:0009628 GO:0009651 GO:0009719 GO:0009725 GO:0009737 GO:0009791 GO:0009892 GO:0009894 GO:0009895 GO:0009908 GO:0010033 GO:0010035 GO:0010506 GO:0010507 GO:0019222 GO:0022414 GO:0031323 GO:0031324 GO:0031329 GO:0031330 GO:0032501 GO:0032502 GO:0033993 GO:0042221 GO:0042538 GO:0048229 GO:0048367 GO:0048519 GO:0048523 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0061458 GO:0065007 GO:0090567 GO:0097305 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TB2_DP1_HVA22

Protein Analysis

47

Amino Acids

5.87

Weight (kDa)

10.73

Isoelectric Point (pI)

70.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016979)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0108651 RchiOBHm_Chr2g0152831
rosa_multiflora	Rmu_sc0000709.1_g000004 Rmu_sc0004724.1_g000001 Rmu_sc0004838.1_g000012 Rmu_sc0008440.1_g000010
rosa_roxburghii	Rroxscaffold_1G00028680
rosa_rugosa	Rorug01G0075900 Rorug05G0382700
rosa_samantha	Rh1DG161100 Rh4DG234000 Rh6CG244200
rosa_wichuraiana	Rw1G017770 Rw6G020850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	39
AfaI	GTAC	1 cut(s)	50
AfiI	CCNNNNNNNGG	1 cut(s)	96
AflIII	ACRYGT	1 cut(s)	12
ApoI	RAATTY	1 cut(s)	39
BccI	CCATC	1 cut(s)	75
Bsc4I	CCNNNNNNNGG	1 cut(s)	96
BseLI	CCNNNNNNNGG	1 cut(s)	96
BseMII	CTCAG	1 cut(s)	35
BslFI	GGGAC	1 cut(s)	73
BslI	CCNNNNNNNGG	1 cut(s)	96
BsmFI	GGGAC	1 cut(s)	73
BspCNI	CTCAG	1 cut(s)	36
BspHI	TCATGA	1 cut(s)	70
Bst6I	CTCTTC	1 cut(s)	49
BstDEI	CTNAG	1 cut(s)	44
BstNSI	RCATGY	1 cut(s)	16
CciI	TCATGA	1 cut(s)	70
Csp6I	GTAC	1 cut(s)	49
CviAII	CATG	2 cut(s)	13, 71
CviJI	RGCY	1 cut(s)	118
CviKI_1	RGCY	1 cut(s)	118
CviQI	GTAC	1 cut(s)	49
DdeI	CTNAG	1 cut(s)	44
Eam1104I	CTCTTC	1 cut(s)	49
EarI	CTCTTC	1 cut(s)	49
FaeI	CATG	2 cut(s)	16, 74
FaiI	YATR	5 cut(s)	14, 27, 29, 72, 142
FaqI	GGGAC	1 cut(s)	73
FatI	CATG	2 cut(s)	12, 70
Hin1II	CATG	2 cut(s)	16, 74
HinfI	GANTC	1 cut(s)	74
Hpy188I	TCNGA	2 cut(s)	21, 45
Hpy188III	TCNNGA	1 cut(s)	71
HpyF3I	CTNAG	1 cut(s)	44
Hsp92II	CATG	2 cut(s)	16, 74
LpnPI	CCDG	2 cut(s)	97, 117
MboII	GAAGA	1 cut(s)	66
MluCI	AATT	2 cut(s)	39, 94
MnlI	CCTC	4 cut(s)	24, 39, 50, 108
NlaIII	CATG	2 cut(s)	16, 74
NspI	RCATGY	1 cut(s)	16
PagI	TCATGA	1 cut(s)	70
PciI	ACATGT	1 cut(s)	12
PfeI	GAWTC	1 cut(s)	74
PscI	ACATGT	1 cut(s)	12
RsaI	GTAC	1 cut(s)	50
RsaNI	GTAC	1 cut(s)	49
SetI	ASST	2 cut(s)	50, 136
SgeI	CNNG	5 cut(s)	18, 25, 83, 97, 124
Sse9I	AATT	2 cut(s)	39, 94
TasI	AATT	2 cut(s)	39, 94
TfiI	GAWTC	1 cut(s)	74
TspDTI	ATGAA	1 cut(s)	66
XapI	RAATTY	1 cut(s)	39
XceI	RCATGY	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.