RchiOBHm_Chr2g0152831

intracellular protein transport protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
70237444 .. 70240116
2673 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52195

Sequence Viewer

Length: 168 bp
ATGGATCAGTCTCAGGCTATAATTAAAGAGTTGGTGTATGAAAAGCAATTGGATAGGCAAGAAATGGATGACTTGATGAAGCAAGATGAGCTAGAAGTTGAAAGAAAGTTGAGAAAGCTTTGGCTGATCTTTTTTTTTAACAACCTTTGGTTGGTCTTAGAATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.89

Weight (kDa)

4.61

Isoelectric Point (pI)

48.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 101
AluBI AGCT 2 cut(s) 91, 118
AluI AGCT 2 cut(s) 91, 118
Alw26I GTCTC 1 cut(s) 15
AlwI GGATC 1 cut(s) 12
BcoDI GTCTC 1 cut(s) 15
BfaI CTAG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 15
Bsp143I GATC 2 cut(s) 4, 126
BspCNI CTCAG 1 cut(s) 25
BspPI GGATC 1 cut(s) 12
BssMI GATC 2 cut(s) 4, 126
BstDEI CTNAG 2 cut(s) 12, 157
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 7, 129
BstMAI GTCTC 1 cut(s) 15
BstMBI GATC 2 cut(s) 4, 126
BstMWI GCNNNNNNNGC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 73
CviJI RGCY 4 cut(s) 17, 91, 118, 124
CviKI_1 RGCY 4 cut(s) 17, 91, 118, 124
DdeI CTNAG 2 cut(s) 12, 157
DpnI GATC 2 cut(s) 6, 128
DpnII GATC 2 cut(s) 4, 126
FaiI YATR 2 cut(s) 20, 39
FokI GGATG 1 cut(s) 80
FspBI CTAG 1 cut(s) 92
FspEI CC 8 cut(s) 17, 35, 40, 50, 106, 133, 137, 158
HindIII AAGCTT 1 cut(s) 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 2 cut(s) 12, 157
Kzo9I GATC 2 cut(s) 4, 126
MaeI CTAG 1 cut(s) 92
MalI GATC 2 cut(s) 6, 128
MboI GATC 2 cut(s) 4, 126
MfeI CAATTG 1 cut(s) 47
MluCI AATT 3 cut(s) 21, 47, 161
MseI TTAA 2 cut(s) 24, 138
MunI CAATTG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 88
NdeII GATC 2 cut(s) 4, 126
SaqAI TTAA 2 cut(s) 24, 138
Sau3AI GATC 2 cut(s) 4, 126
SetI ASST 3 cut(s) 93, 120, 147
SgeI CNNG 5 cut(s) 26, 71, 85, 95, 104
Sse9I AATT 3 cut(s) 21, 47, 161
SspMI CTAG 1 cut(s) 92
TasI AATT 3 cut(s) 21, 47, 161
Tru1I TTAA 2 cut(s) 24, 138
Tru9I TTAA 2 cut(s) 24, 138
TspDTI ATGAA 2 cut(s) 54, 92
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.