RchiOBHm_Chr2g0161521

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
77400786 .. 77400980
195 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52987

Sequence Viewer

Length: 195 bp
ATGCAGGTTTTTGTGAAGACTTTGACAGGCAAGACAATCACTCTGGAGGTTGAGAGCTCCGATACCATTGACAATGTCAAAGCAAAGATTCAAGACAAAAAAGGAATCCCACCGGACCAGCAGAGGTTGATCTTTGCTGGTCCGGTGTGCGGGATCCCTTTACTGGTGCACCGTCGACCGACCTTGATCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.12

Weight (kDa)

9.43

Isoelectric Point (pI)

22.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 47 2.5e-09 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 47 4.2e-18 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017872)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 175
AciI CCGC 1 cut(s) 150
AclWI GGATC 2 cut(s) 148, 161
AfiI CCNNNNNNNGG 2 cut(s) 149, 163
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
Alw21I GWGCWC 2 cut(s) 59, 171
Alw44I GTGCAC 1 cut(s) 167
AlwI GGATC 2 cut(s) 148, 161
ApaLI GTGCAC 1 cut(s) 167
AspS9I GGNCC 2 cut(s) 115, 140
AvaII GGWCC 2 cut(s) 115, 140
BaeGI GKGCMC 1 cut(s) 171
BamHI GGATCC 1 cut(s) 153
BanII GRGCYC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 23
Bbv12I GWGCWC 2 cut(s) 59, 171
Bme18I GGWCC 2 cut(s) 115, 140
BmgT120I GGNCC 2 cut(s) 115, 140
BmiI GGNNCC 1 cut(s) 155
BpiI GAAGAC 1 cut(s) 23
BpmI CTGGAG 1 cut(s) 65
BsaWI WCCGGW 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 163
Bse1I ACTGG 1 cut(s) 168
BseLI CCNNNNNNNGG 2 cut(s) 149, 163
BseNI ACTGG 1 cut(s) 168
BseSI GKGCMC 1 cut(s) 171
Bsh1285I CGRYCG 1 cut(s) 179
BsiEI CGRYCG 1 cut(s) 179
BsiHKAI GWGCWC 2 cut(s) 59, 171
BsiSI CCGG 2 cut(s) 113, 143
BslI CCNNNNNNNGG 2 cut(s) 149, 163
Bsp1286I GDGCHC 2 cut(s) 59, 171
Bsp143I GATC 3 cut(s) 129, 153, 186
BspACI CCGC 1 cut(s) 150
BspLI GGNNCC 1 cut(s) 155
BspPI GGATC 2 cut(s) 148, 161
BsrI ACTGG 1 cut(s) 168
BssMI GATC 3 cut(s) 129, 153, 186
Bst4CI ACNGT 1 cut(s) 173
BstKTI GATC 3 cut(s) 132, 156, 189
BstMBI GATC 3 cut(s) 129, 153, 186
BstMCI CGRYCG 1 cut(s) 179
BstSLI GKGCMC 1 cut(s) 171
BstV2I GAAGAC 1 cut(s) 23
BstX2I RGATCY 1 cut(s) 153
BstYI RGATCY 1 cut(s) 153
Cfr13I GGNCC 2 cut(s) 115, 140
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
DpnI GATC 3 cut(s) 131, 155, 188
DpnII GATC 3 cut(s) 129, 153, 186
Ecl136II GAGCTC 1 cut(s) 57
Eco24I GRGCYC 1 cut(s) 59
Eco47I GGWCC 2 cut(s) 115, 140
Eco53kI GAGCTC 1 cut(s) 57
EcoICRI GAGCTC 1 cut(s) 57
EcoT38I GRGCYC 1 cut(s) 59
FauI CCCGC 1 cut(s) 143
FblI GTMKAC 1 cut(s) 175
FriOI GRGCYC 1 cut(s) 59
GsuI CTGGAG 1 cut(s) 65
HapII CCGG 2 cut(s) 113, 143
HincII GTYRAC 1 cut(s) 176
HindII GTYRAC 1 cut(s) 176
HinfI GANTC 2 cut(s) 88, 105
HpaII CCGG 2 cut(s) 113, 143
Hpy166II GTNNAC 2 cut(s) 169, 176
Hpy188I TCNGA 2 cut(s) 61, 194
Hpy188III TCNNGA 2 cut(s) 44, 92
Hpy8I GTNNAC 2 cut(s) 169, 176
Hpy99I CGWCG 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 2 cut(s) 4, 169
Kzo9I GATC 3 cut(s) 129, 153, 186
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 7 cut(s) 12, 29, 123, 126, 131, 149, 156
MalI GATC 3 cut(s) 131, 155, 188
MboI GATC 3 cut(s) 129, 153, 186
MboII GAAGA 2 cut(s) 28, 181
MflI RGATCY 1 cut(s) 153
MhlI GDGCHC 2 cut(s) 59, 171
MnlI CCTC 2 cut(s) 40, 117
MspI CCGG 2 cut(s) 113, 143
NdeII GATC 3 cut(s) 129, 153, 186
NlaIV GGNNCC 1 cut(s) 155
PfeI GAWTC 2 cut(s) 88, 105
PflFI GACNNNGTC 1 cut(s) 74
Psp124BI GAGCTC 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 155
PspPI GGNCC 2 cut(s) 115, 140
PsuI RGATCY 1 cut(s) 153
PsyI GACNNNGTC 1 cut(s) 74
SacI GAGCTC 1 cut(s) 59
SalI GTCGAC 1 cut(s) 174
Sau3AI GATC 3 cut(s) 129, 153, 186
Sau96I GGNCC 2 cut(s) 115, 140
SduI GDGCHC 2 cut(s) 59, 171
SetI ASST 5 cut(s) 9, 51, 59, 128, 185
SinI GGWCC 2 cut(s) 115, 140
SsiI CCGC 1 cut(s) 150
SstI GAGCTC 1 cut(s) 59
TaaI ACNGT 1 cut(s) 173
TaqI TCGA 1 cut(s) 175
TaqII GACCGA 1 cut(s) 193
TfiI GAWTC 2 cut(s) 88, 105
Tth111I GACNNNGTC 1 cut(s) 74
VneI GTGCAC 1 cut(s) 167
VpaK11BI GGWCC 2 cut(s) 115, 140
XmiI GTMKAC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.