Rroxscaffold_1G00053410

Ubiquitin-like domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
74294825 .. 74296806
1982 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00053410.1

Sequence Viewer

Length: 303 bp
ATGCAGATTTTCGTGAAAACCCTAACCGGGAAGACCATCACCCTTGAAGTTGAGAGCAGCGACACCATCGACAATGTCAAAGCCAAGATCCAGGATTATAATATCCAAAAAGAGTCAACTCTCCACCTTGTTTTGAGGTTGAGGGGAGGAACTATGATTAAGGTGAAGACTCTTACCGGGAAAGAAATTGAAATTGATATTGAACCAACTGATACCATTGACCGGATCAAGGAAAGAGTTGAGGAGAAAGAGGGCATTCCTCCAGTGCAGCAAAGGTATATATATGTTGTTATACTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.53

Weight (kDa)

5.84

Isoelectric Point (pI)

36.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 32 9.4e-08 Ubiquitin family
ubiquitin PF00240 53 - 95 2.2e-12 Ubiquitin family
Rad60-SLD PF11976 53 - 94 8.5e-06 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017872)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 99
AclWI GGATC 2 cut(s) 82, 233
AfiI CCNNNNNNNGG 3 cut(s) 27, 222, 229
AgsI TTSAA 3 cut(s) 47, 191, 203
AjnI CCWGG 1 cut(s) 90
AlwI GGATC 2 cut(s) 82, 233
ApeKI GCWGC 2 cut(s) 57, 268
AsuC2I CCSGG 2 cut(s) 28, 178
AsuHPI GGTGA 2 cut(s) 31, 175
BbsI GAAGAC 2 cut(s) 38, 173
BbvI GCAGC 2 cut(s) 69, 280
BccI CCATC 2 cut(s) 44, 74
BciT130I CCWGG 1 cut(s) 92
BcnI CCSGG 2 cut(s) 28, 178
BisI GCNGC 2 cut(s) 58, 269
BlsI GCNGC 2 cut(s) 59, 270
Bme1390I CCNGG 3 cut(s) 28, 92, 178
BmrFI CCNGG 3 cut(s) 28, 92, 178
BpiI GAAGAC 2 cut(s) 38, 173
BpmI CTGGAG 1 cut(s) 246
BpuMI CCSGG 2 cut(s) 28, 178
BsaWI WCCGGW 1 cut(s) 222
Bsc4I CCNNNNNNNGG 3 cut(s) 27, 222, 229
Bse1I ACTGG 1 cut(s) 263
BseBI CCWGG 1 cut(s) 92
BseLI CCNNNNNNNGG 3 cut(s) 27, 222, 229
BseNI ACTGG 1 cut(s) 263
BseRI GAGGAG 1 cut(s) 257
BseXI GCAGC 2 cut(s) 69, 280
BsgI GTGCAG 1 cut(s) 287
BsiSI CCGG 3 cut(s) 27, 177, 223
BslI CCNNNNNNNGG 3 cut(s) 27, 222, 229
BsmI GAATGC 1 cut(s) 255
Bsp143I GATC 2 cut(s) 87, 225
BspPI GGATC 2 cut(s) 82, 233
BsrI ACTGG 1 cut(s) 263
BssMI GATC 2 cut(s) 87, 225
Bst2UI CCWGG 1 cut(s) 92
BstKTI GATC 2 cut(s) 90, 228
BstMBI GATC 2 cut(s) 87, 225
BstNI CCWGG 1 cut(s) 92
BstSCI CCNGG 3 cut(s) 26, 90, 176
BstV1I GCAGC 2 cut(s) 69, 280
BstV2I GAAGAC 2 cut(s) 38, 173
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
BtsIMutI CAGTG 1 cut(s) 270
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DpnI GATC 2 cut(s) 89, 227
DpnII GATC 2 cut(s) 87, 225
EcoRII CCWGG 1 cut(s) 90
FaiI YATR 7 cut(s) 99, 155, 279, 281, 283, 285, 293
Fnu4HI GCNGC 2 cut(s) 58, 269
Fsp4HI GCNGC 2 cut(s) 58, 269
GluI GCNGC 2 cut(s) 58, 269
GsuI CTGGAG 1 cut(s) 246
HapII CCGG 3 cut(s) 27, 177, 223
HincII GTYRAC 1 cut(s) 117
HindII GTYRAC 1 cut(s) 117
HinfI GANTC 2 cut(s) 113, 169
HpaII CCGG 3 cut(s) 27, 177, 223
HphI GGTGA 2 cut(s) 31, 175
Hpy166II GTNNAC 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 4, 268
Kzo9I GATC 2 cut(s) 87, 225
LpnPI CCDG 6 cut(s) 40, 77, 104, 190, 236, 276
Lsp1109I GCAGC 2 cut(s) 69, 280
MalI GATC 2 cut(s) 89, 227
MboI GATC 2 cut(s) 87, 225
MboII GAAGA 2 cut(s) 43, 178
MflI RGATCY 1 cut(s) 87
MluCI AATT 2 cut(s) 186, 192
MlyI GAGTC 2 cut(s) 122, 163
MnlI CCTC 6 cut(s) 129, 135, 140, 235, 244, 270
MseI TTAA 1 cut(s) 159
MspI CCGG 3 cut(s) 27, 177, 223
MspR9I CCNGG 3 cut(s) 28, 92, 178
Mva1269I GAATGC 1 cut(s) 255
MvaI CCWGG 1 cut(s) 92
NciI CCSGG 2 cut(s) 28, 178
NdeII GATC 2 cut(s) 87, 225
PctI GAATGC 1 cut(s) 255
PflFI GACNNNGTC 1 cut(s) 74
PfoI TCCNGGA 1 cut(s) 90
PkrI GCNGC 2 cut(s) 59, 270
PleI GAGTC 2 cut(s) 121, 163
PpsI GAGTC 2 cut(s) 121, 163
PsiI TTATAA 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PsuI RGATCY 1 cut(s) 87
PsyI GACNNNGTC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 2 cut(s) 58, 269
Sau3AI GATC 2 cut(s) 87, 225
SchI GAGTC 2 cut(s) 122, 163
ScrFI CCNGG 3 cut(s) 28, 92, 178
SetI ASST 4 cut(s) 129, 140, 165, 278
Sse9I AATT 2 cut(s) 186, 192
StyD4I CCNGG 3 cut(s) 26, 90, 176
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 186, 192
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 270
TseI GCWGC 2 cut(s) 57, 268
TspRI CASTG 1 cut(s) 270
Tth111I GACNNNGTC 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.