Rmu_sc0007744.1_g000001

Ubiquitin-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007744.1
OG0017872
Physical Location & Seq
Reverse (-)
1331 .. 2524
1194 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007744.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atgcagattttcgtgaagactctaactgggaagaccatcactctcgaggttgagagcagcgacaccatcgataatgtcaaagccaagatccagccatgtaatatacacttagtcactcttcacctggttttgaggctgtggggaggaactatgattaaggtgaagactcttaccgggaaagaaattgagattgatattgaaccgactgacaccattaaccgaatcaaggaaagggttgaggagaaagagggaattcctccggtgcaacaaaggtacttttttgctggtcccttcttggcctggtggcctttgctttatttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

107

Amino Acids

12.32

Weight (kDa)

6.73

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017872)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g20951
rosa_chinensis RchiOBHm_Chr2g0161521 RchiOBHm_Chr3g0478151
rosa_multiflora Rmu_sc0007744.1_g000001
rosa_roxburghii Rroxscaffold_1G00053410
rosa_samantha Rh3AG215300 Rh3BG248900 Rh5AG180600 Rh5BG179200
rosa_wichuraiana Rw2G046050 Rw3G019570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 82
AcsI RAATTY 1 cut(s) 252
AfaI GTAC 1 cut(s) 275
AfiI CCNNNNNNNGG 1 cut(s) 226
AgsI TTSAA 1 cut(s) 200
AjnI CCWGG 2 cut(s) 123, 299
AlwI GGATC 1 cut(s) 82
Ama87I CYCGRG 1 cut(s) 44
AoxI GGCC 2 cut(s) 297, 305
ApeKI GCWGC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 252
AspS9I GGNCC 1 cut(s) 287
AsuC2I CCSGG 1 cut(s) 175
AsuHPI GGTGA 2 cut(s) 113, 172
AvaI CYCGRG 1 cut(s) 44
AvaII GGWCC 1 cut(s) 287
BbsI GAAGAC 3 cut(s) 23, 38, 170
BbvI GCAGC 1 cut(s) 69
BccI CCATC 2 cut(s) 44, 74
BciT130I CCWGG 2 cut(s) 125, 301
BcnI CCSGG 1 cut(s) 175
BisI GCNGC 1 cut(s) 58
BlsI GCNGC 1 cut(s) 59
Bme1390I CCNGG 3 cut(s) 125, 175, 301
Bme18I GGWCC 1 cut(s) 287
BmeT110I CYCGRG 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 287
BmiI GGNNCC 1 cut(s) 289
BmrFI CCNGG 3 cut(s) 125, 175, 301
BmrI ACTGGG 1 cut(s) 36
BmuI ACTGGG 1 cut(s) 36
BpiI GAAGAC 3 cut(s) 23, 38, 170
BpuMI CCSGG 1 cut(s) 175
Bsa29I ATCGAT 1 cut(s) 69
BsaWI WCCGGW 1 cut(s) 259
Bsc4I CCNNNNNNNGG 1 cut(s) 226
Bse1I ACTGG 1 cut(s) 31
BseBI CCWGG 2 cut(s) 125, 301
BseCI ATCGAT 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 31
BseRI GAGGAG 1 cut(s) 254
BseXI GCAGC 1 cut(s) 69
BshFI GGCC 2 cut(s) 299, 307
BshVI ATCGAT 1 cut(s) 69
BsiHKCI CYCGRG 1 cut(s) 44
BsiSI CCGG 2 cut(s) 174, 260
BslFI GGGAC 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 226
BsmFI GGGAC 1 cut(s) 273
BsnI GGCC 2 cut(s) 299, 307
BsoBI CYCGRG 1 cut(s) 44
Bsp143I GATC 1 cut(s) 87
BspANI GGCC 2 cut(s) 299, 307
BspDI ATCGAT 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 289
BspPI GGATC 1 cut(s) 82
BsrI ACTGG 1 cut(s) 31
BssMI GATC 1 cut(s) 87
Bst2UI CCWGG 2 cut(s) 125, 301
Bst6I CTCTTC 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstNI CCWGG 2 cut(s) 125, 301
BstSCI CCNGG 3 cut(s) 123, 173, 299
BstV1I GCAGC 1 cut(s) 69
BstV2I GAAGAC 3 cut(s) 23, 38, 170
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
Bsu15I ATCGAT 1 cut(s) 69
BsuRI GGCC 2 cut(s) 299, 307
BsuTUI ATCGAT 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 287
ClaI ATCGAT 1 cut(s) 69
CsiI ACCWGGT 1 cut(s) 123
Csp6I GTAC 1 cut(s) 274
CviAII CATG 1 cut(s) 96
CviJI RGCY 5 cut(s) 83, 94, 136, 299, 307
CviKI_1 RGCY 5 cut(s) 83, 94, 136, 299, 307
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 1 cut(s) 109
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 287
Eco88I CYCGRG 1 cut(s) 44
EcoRI GAATTC 1 cut(s) 252
EcoRII CCWGG 2 cut(s) 123, 299
FaeI CATG 1 cut(s) 99
FaiI YATR 3 cut(s) 97, 104, 152
FaqI GGGAC 1 cut(s) 273
FatI CATG 1 cut(s) 95
Fnu4HI GCNGC 1 cut(s) 58
Fsp4HI GCNGC 1 cut(s) 58
GluI GCNGC 1 cut(s) 58
HaeIII GGCC 2 cut(s) 299, 307
HapII CCGG 2 cut(s) 174, 260
Hin1II CATG 1 cut(s) 99
HinfI GANTC 3 cut(s) 19, 166, 222
HpaII CCGG 2 cut(s) 174, 260
HphI GGTGA 2 cut(s) 113, 172
Hpy188III TCNNGA 2 cut(s) 13, 44
HpyAV CCTTC 1 cut(s) 301
HpyCH4V TGCA 2 cut(s) 4, 265
HpyF3I CTNAG 1 cut(s) 109
Hsp92II CATG 1 cut(s) 99
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 9 cut(s) 12, 104, 110, 137, 187, 270, 273, 286, 313
Lsp1109I GCAGC 1 cut(s) 69
MabI ACCWGGT 1 cut(s) 123
MaeIII GTNAC 1 cut(s) 112
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 4 cut(s) 28, 43, 110, 175
MflI RGATCY 1 cut(s) 87
MluCI AATT 2 cut(s) 183, 252
MlyI GAGTC 2 cut(s) 13, 160
MnlI CCTC 6 cut(s) 40, 126, 137, 232, 241, 267
MseI TTAA 2 cut(s) 156, 216
MspI CCGG 2 cut(s) 174, 260
MspR9I CCNGG 3 cut(s) 125, 175, 301
MvaI CCWGG 2 cut(s) 125, 301
NciI CCSGG 1 cut(s) 175
NdeII GATC 1 cut(s) 87
NlaIII CATG 1 cut(s) 99
NlaIV GGNNCC 1 cut(s) 289
NmuCI GTSAC 1 cut(s) 112
PaeR7I CTCGAG 1 cut(s) 44
PfeI GAWTC 1 cut(s) 222
PkrI GCNGC 1 cut(s) 59
PleI GAGTC 2 cut(s) 13, 160
PpsI GAGTC 2 cut(s) 13, 160
Psp6I CCWGG 2 cut(s) 123, 299
PspGI CCWGG 2 cut(s) 123, 299
PspN4I GGNNCC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 287
PsuI RGATCY 1 cut(s) 87
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
SaqAI TTAA 2 cut(s) 156, 216
SatI GCNGC 1 cut(s) 58
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 287
SchI GAGTC 2 cut(s) 13, 160
ScrFI CCNGG 3 cut(s) 125, 175, 301
SetI ASST 4 cut(s) 51, 126, 162, 275
SexAI ACCWGGT 1 cut(s) 123
Sfr274I CTCGAG 1 cut(s) 44
SinI GGWCC 1 cut(s) 287
SlaI CTCGAG 1 cut(s) 44
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 2 cut(s) 183, 252
StyD4I CCNGG 3 cut(s) 123, 173, 299
TaqI TCGA 2 cut(s) 45, 69
TasI AATT 2 cut(s) 183, 252
TfiI GAWTC 1 cut(s) 222
Tru1I TTAA 2 cut(s) 156, 216
Tru9I TTAA 2 cut(s) 156, 216
TseFI GTSAC 1 cut(s) 112
TseI GCWGC 1 cut(s) 57
Tsp45I GTSAC 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 287
XapI RAATTY 1 cut(s) 252
XhoI CTCGAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.