RchiOBHm_Chr3g0481081

tRNA pseudouridine

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
27160602 .. 27165852
5251 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44605

Sequence Viewer

Length: 243 bp
ATGTTCTGCTCAAGTCGAACTGATGCAGGAGTCCATGCCTTATCCAATGTTAGTCATGTAGATACTGAACGCATAAGCAAAAGAAAGCCTGGTGAAGTGTTACCACCTCATGAACCTACAGTGGTCCAAAAAGCTGTAAACCATTTCTTACAGAAGAATGAAGGTGATGTAATGGTGGTGGATGTACGAAAAGTTCCAGCTGATTTTCATGCTAGATTTAAAGCCCAAGAACGCACAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.98

Weight (kDa)

8.98

Isoelectric Point (pI)

25.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 186
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 2 cut(s) 134, 200
AluI AGCT 2 cut(s) 134, 200
AspS9I GGNCC 1 cut(s) 124
AsuHPI GGTGA 2 cut(s) 104, 176
AvaII GGWCC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 90
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 13
BseBI CCWGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 187
BspHI TCATGA 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 121
BstF5I GGATG 1 cut(s) 187
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 126
CciI TCATGA 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 185
CviAII CATG 4 cut(s) 35, 56, 110, 209
CviJI RGCY 4 cut(s) 88, 134, 200, 224
CviKI_1 RGCY 4 cut(s) 88, 134, 200, 224
CviQI GTAC 1 cut(s) 185
DraI TTTAAA 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 88
FaeI CATG 4 cut(s) 38, 59, 113, 212
FaiI YATR 6 cut(s) 36, 57, 74, 111, 210, 241
FatI CATG 4 cut(s) 34, 55, 109, 208
FokI GGATG 1 cut(s) 194
FspBI CTAG 1 cut(s) 213
Hin1II CATG 4 cut(s) 38, 59, 113, 212
HinfI GANTC 1 cut(s) 30
HphI GGTGA 2 cut(s) 104, 176
Hpy166II GTNNAC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 26
Hsp92II CATG 4 cut(s) 38, 59, 113, 212
LpnPI CCDG 4 cut(s) 12, 75, 102, 210
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 99
MboII GAAGA 1 cut(s) 166
MlyI GAGTC 1 cut(s) 39
MnlI CCTC 1 cut(s) 117
MseI TTAA 1 cut(s) 219
MspA1I CMGCKG 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
NlaIII CATG 4 cut(s) 38, 59, 113, 212
PagI TCATGA 1 cut(s) 109
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 124
PsrI GAACNNNNNNTAC 2 cut(s) 177, 209
PvuII CAGCTG 1 cut(s) 200
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SaqAI TTAA 1 cut(s) 219
Sau96I GGNCC 1 cut(s) 124
SchI GAGTC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 90
SetI ASST 5 cut(s) 109, 118, 136, 166, 202
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 117
SinI GGWCC 1 cut(s) 124
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 121
TaqI TCGA 1 cut(s) 16
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 1 cut(s) 126
TspDTI ATGAA 3 cut(s) 126, 174, 197
TspRI CASTG 1 cut(s) 126
VpaK11BI GGWCC 1 cut(s) 124
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.