Rroxscaffold_7G00212020

tRNA pseudouridine

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
62445670 .. 62450417
4748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00212020.1

Sequence Viewer

Length: 186 bp
ATGTTCTGCTCAAGTCGCACTGATGCAGGAGTCCATGCCTTATCCAATGTTTGTCATGTAGATATTGAACGCATAAGCAAAAGAAGGCCTGGTGAAGTGTTACCACCTCATGAACCTACAGTGGTCCAAAAAGCTGTAAACCATTTCTTACAGCAACATTTGTCTACTCAGAAGTGGTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.03

Weight (kDa)

8.81

Isoelectric Point (pI)

63.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 164
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AoxI GGCC 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 1 cut(s) 124
BarI GAAGNNNNNNTAC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 90
BfaI CTAG 1 cut(s) 184
BfmI CTRYAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 13
BseBI CCWGG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 182
BshFI GGCC 1 cut(s) 88
BsnI GGCC 1 cut(s) 88
BspANI GGCC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 181
BspHI TCATGA 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 168
BstMWI GCNNNNNNNGC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 88
BtsIMutI CAGTG 2 cut(s) 18, 126
CciI TCATGA 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 124
CviAII CATG 3 cut(s) 35, 56, 110
CviJI RGCY 2 cut(s) 88, 134
CviKI_1 RGCY 2 cut(s) 88, 134
DdeI CTNAG 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 88
FaeI CATG 3 cut(s) 38, 59, 113
FaiI YATR 4 cut(s) 36, 57, 74, 111
FatI CATG 3 cut(s) 34, 55, 109
FblI GTMKAC 1 cut(s) 164
FspBI CTAG 1 cut(s) 184
HaeIII GGCC 1 cut(s) 88
Hin1II CATG 3 cut(s) 38, 59, 113
HinfI GANTC 1 cut(s) 30
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 2 cut(s) 139, 165
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 2 cut(s) 139, 165
HpyAV CCTTC 1 cut(s) 78
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 3 cut(s) 38, 59, 113
LpnPI CCDG 3 cut(s) 12, 75, 102
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 99
MlyI GAGTC 1 cut(s) 39
MnlI CCTC 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 15
NlaIII CATG 3 cut(s) 38, 59, 113
PagI TCATGA 1 cut(s) 109
PceI AGGCCT 1 cut(s) 88
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 124
SchI GAGTC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 90
SetI ASST 3 cut(s) 109, 118, 136
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 7 cut(s) 24, 39, 47, 68, 101, 102, 122
SinI GGWCC 1 cut(s) 124
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
SseBI AGGCCT 1 cut(s) 88
SspMI CTAG 1 cut(s) 184
StuI AGGCCT 1 cut(s) 88
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 121
TscAI CASTG 2 cut(s) 25, 126
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 2 cut(s) 25, 126
VpaK11BI GGWCC 1 cut(s) 124
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.