RchiOBHm_Chr3g0488751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
36391551 .. 36396819
5269 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45307

Sequence Viewer

Length: 198 bp
ATGTGGACCTTATGGAATATGCGAGAAATAAAGAATGATCAGATTTTTGTTGCATCTATAGCAGAAAGTTCATTTCACGACGACAGCACACATGATCAAATCATGCCATCCACTCTTAAATGCTTCAAAATACAAGTACACAAGAAGAAGGCAAGAGCACACATGCCAAGAAGGATTAGAAACTGCAACTCCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.78

Weight (kDa)

9.78

Isoelectric Point (pI)

44.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 138
AgsI TTSAA 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 160
AspS9I GGNCC 1 cut(s) 6
AvaII GGWCC 1 cut(s) 6
Bbv12I GWGCWC 1 cut(s) 160
BccI CCATC 1 cut(s) 115
BclI TGATCA 2 cut(s) 37, 94
BfmI CTRYAG 1 cut(s) 57
Bme18I GGWCC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 62
BsaXI ACNNNNNCTCC 1 cut(s) 173
BseGI GGATG 1 cut(s) 107
BsiHKAI GWGCWC 1 cut(s) 160
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 2 cut(s) 37, 94
BssMI GATC 2 cut(s) 37, 94
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 2 cut(s) 40, 97
BstMBI GATC 2 cut(s) 37, 94
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNSI RCATGY 1 cut(s) 166
BstSFI CTRYAG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 137
CviAII CATG 3 cut(s) 92, 103, 163
CviQI GTAC 1 cut(s) 137
DpnI GATC 2 cut(s) 39, 96
DpnII GATC 2 cut(s) 37, 94
Eco47I GGWCC 1 cut(s) 6
FaeI CATG 3 cut(s) 95, 106, 166
FaiI YATR 6 cut(s) 13, 20, 59, 93, 104, 164
FatI CATG 3 cut(s) 91, 102, 162
FbaI TGATCA 2 cut(s) 37, 94
FokI GGATG 1 cut(s) 94
FspEI CC 6 cut(s) 22, 120, 124, 134, 157, 180
Hin1II CATG 3 cut(s) 95, 106, 166
Hpy166II GTNNAC 2 cut(s) 6, 139
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 2 cut(s) 6, 139
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 2 cut(s) 142, 165
HpyCH4V TGCA 2 cut(s) 53, 186
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
Hsp92II CATG 3 cut(s) 95, 106, 166
Ksp22I TGATCA 2 cut(s) 37, 94
Kzo9I GATC 2 cut(s) 37, 94
LweI GCATC 1 cut(s) 62
MalI GATC 2 cut(s) 39, 96
MboI GATC 2 cut(s) 37, 94
MboII GAAGA 1 cut(s) 157
MhlI GDGCHC 1 cut(s) 160
MseI TTAA 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 59
NdeII GATC 2 cut(s) 37, 94
NlaIII CATG 3 cut(s) 95, 106, 166
NspI RCATGY 1 cut(s) 166
PspPI GGNCC 1 cut(s) 6
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 2 cut(s) 37, 94
Sau96I GGNCC 1 cut(s) 6
SduI GDGCHC 1 cut(s) 160
SetI ASST 1 cut(s) 11
SfaNI GCATC 1 cut(s) 62
SfcI CTRYAG 1 cut(s) 57
SgeI CNNG 9 cut(s) 35, 89, 104, 115, 146, 154, 165, 175, 180
SinI GGWCC 1 cut(s) 6
TatI WGTACW 1 cut(s) 136
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 60
VpaK11BI GGWCC 1 cut(s) 6
XceI RCATGY 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.