RchiOBHm_Chr5g0027711

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
21593517 .. 21594497
981 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30726

Sequence Viewer

Length: 165 bp
ATGACAAGAAAAATGAAGGCTCGAGAAAGTGATCATAGCTCAGCAAATATAATGAAAAGCTTATCAAGTAAGGGAGATATGGGAGAAATGAAGAATGATCAGACTATAGATATGGGAGCAACTAGAACGACTATTTTTTGGAAAATGTTCCAACAGCAACTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.23

Weight (kDa)

9.69

Isoelectric Point (pI)

42.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 39, 60
AluI AGCT 2 cut(s) 39, 60
AlwNI CAGNNNCTG 1 cut(s) 160
Ama87I CYCGRG 1 cut(s) 21
Asp700I GAANNNNTTC 1 cut(s) 146
AvaI CYCGRG 1 cut(s) 21
BclI TGATCA 2 cut(s) 31, 97
BfaI CTAG 1 cut(s) 123
BfmI CTRYAG 1 cut(s) 105
BlpI GCTNAGC 1 cut(s) 40
BmeT110I CYCGRG 1 cut(s) 21
Bpu1102I GCTNAGC 1 cut(s) 40
BseMII CTCAG 1 cut(s) 54
BsiHKCI CYCGRG 1 cut(s) 21
BsoBI CYCGRG 1 cut(s) 21
Bsp143I GATC 2 cut(s) 31, 97
Bsp1720I GCTNAGC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 53
BssMI GATC 2 cut(s) 31, 97
Bst4CI ACNGT 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 40
BstKTI GATC 2 cut(s) 34, 100
BstMBI GATC 2 cut(s) 31, 97
BstSFI CTRYAG 1 cut(s) 105
CaiI CAGNNNCTG 1 cut(s) 160
CviJI RGCY 3 cut(s) 20, 39, 60
CviKI_1 RGCY 3 cut(s) 20, 39, 60
DdeI CTNAG 1 cut(s) 40
DpnI GATC 2 cut(s) 33, 99
DpnII GATC 2 cut(s) 31, 97
Eco88I CYCGRG 1 cut(s) 21
FaiI YATR 5 cut(s) 36, 50, 80, 107, 113
FbaI TGATCA 2 cut(s) 31, 97
FspBI CTAG 1 cut(s) 123
FspEI CC 8 cut(s) 2, 56, 57, 65, 66, 98, 99, 124
HindIII AAGCTT 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 162
HpyF3I CTNAG 1 cut(s) 40
Ksp22I TGATCA 2 cut(s) 31, 97
Kzo9I GATC 2 cut(s) 31, 97
LmnI GCTCC 1 cut(s) 116
MaeI CTAG 1 cut(s) 123
MalI GATC 2 cut(s) 33, 99
MboI GATC 2 cut(s) 31, 97
MboII GAAGA 1 cut(s) 103
MroXI GAANNNNTTC 1 cut(s) 146
NdeII GATC 2 cut(s) 31, 97
PaeR7I CTCGAG 1 cut(s) 21
PdmI GAANNNNTTC 1 cut(s) 146
PstNI CAGNNNCTG 1 cut(s) 160
Sau3AI GATC 2 cut(s) 31, 97
SetI ASST 2 cut(s) 41, 62
SfcI CTRYAG 1 cut(s) 105
Sfr274I CTCGAG 1 cut(s) 21
SgeI CNNG 5 cut(s) 18, 33, 35, 78, 135
SlaI CTCGAG 1 cut(s) 21
SmlI CTYRAG 1 cut(s) 21
SmoI CTYRAG 1 cut(s) 21
SspMI CTAG 1 cut(s) 123
TaaI ACNGT 1 cut(s) 162
TaqI TCGA 1 cut(s) 22
TspDTI ATGAA 3 cut(s) 29, 68, 104
XhoI CTCGAG 1 cut(s) 21
XmnI GAANNNNTTC 1 cut(s) 146
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.