Rh2BG623700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
84553922 .. 84554832
911 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG623700.1

Sequence Viewer

Length: 231 bp
ATGAAACTATTAGACCATCAGATCATAGTAGACCCATGCACTGTTTCATTAAACCCTCTTAAGTTTTGGATTGCTACATTTTGCTTTCTTGTTACGGCATCTACATTGAGGACAACAAAAAAAAGAAAAAGAAGGCTCTTAGAAGGTGATCATACCTTAGCAAATTTATGTCATGCTGCAAGTTATAATGAAAGCTTATCAAGTCAAGGATATGAGAGAAATAAGGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.67

Weight (kDa)

9.45

Isoelectric Point (pI)

40.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AccI GTMKAC 1 cut(s) 30
AcsI RAATTY 1 cut(s) 163
AflII CTTAAG 1 cut(s) 59
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
ApeKI GCWGC 1 cut(s) 176
ApoI RAATTY 1 cut(s) 163
AsuHPI GGTGA 1 cut(s) 158
BbvI GCAGC 1 cut(s) 163
BccI CCATC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 111
BclI TGATCA 1 cut(s) 148
BfrI CTTAAG 1 cut(s) 59
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
BmsI GCATC 1 cut(s) 107
Bpu10I CCTNAGC 1 cut(s) 157
BseXI GCAGC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 21, 148
BspTI CTTAAG 1 cut(s) 59
BssMI GATC 2 cut(s) 21, 148
Bst4CI ACNGT 1 cut(s) 43
BstAFI CTTAAG 1 cut(s) 59
BstDEI CTNAG 2 cut(s) 139, 157
BstKTI GATC 2 cut(s) 24, 151
BstMBI GATC 2 cut(s) 21, 148
BstV1I GCAGC 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 39
CviAII CATG 2 cut(s) 36, 173
CviJI RGCY 2 cut(s) 136, 195
CviKI_1 RGCY 2 cut(s) 136, 195
DdeI CTNAG 2 cut(s) 139, 157
DpnI GATC 2 cut(s) 23, 150
DpnII GATC 2 cut(s) 21, 148
FaeI CATG 2 cut(s) 39, 176
FaiI YATR 7 cut(s) 26, 37, 153, 169, 174, 186, 213
FatI CATG 2 cut(s) 35, 172
FbaI TGATCA 1 cut(s) 148
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
Hin1II CATG 2 cut(s) 39, 176
HindIII AAGCTT 1 cut(s) 193
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 2 cut(s) 126, 137
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 39, 179
HpyF3I CTNAG 2 cut(s) 139, 157
Hsp92II CATG 2 cut(s) 39, 176
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 2 cut(s) 21, 148
Lsp1109I GCAGC 1 cut(s) 163
LweI GCATC 1 cut(s) 107
MaeIII GTNAC 1 cut(s) 91
MalI GATC 2 cut(s) 23, 150
MboI GATC 2 cut(s) 21, 148
MluCI AATT 1 cut(s) 163
MnlI CCTC 2 cut(s) 66, 102
MseI TTAA 2 cut(s) 50, 60
MspCI CTTAAG 1 cut(s) 59
NdeII GATC 2 cut(s) 21, 148
NlaIII CATG 2 cut(s) 39, 176
PkrI GCNGC 1 cut(s) 178
PsiI TTATAA 1 cut(s) 186
SaqAI TTAA 2 cut(s) 50, 60
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 2 cut(s) 21, 148
SetI ASST 3 cut(s) 148, 158, 197
SfaNI GCATC 1 cut(s) 107
SgeI CNNG 6 cut(s) 48, 101, 185, 192, 213, 218
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
Sse9I AATT 1 cut(s) 163
TaaI ACNGT 1 cut(s) 43
TasI AATT 1 cut(s) 163
Tru1I TTAA 2 cut(s) 50, 60
Tru9I TTAA 2 cut(s) 50, 60
TscAI CASTG 1 cut(s) 46
TseI GCWGC 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 17, 36, 204
TspRI CASTG 1 cut(s) 46
Vha464I CTTAAG 1 cut(s) 59
XapI RAATTY 1 cut(s) 163
XmiI GTMKAC 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.