RchiOBHm_Chr5g0076981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
82770090 .. 82772802
2713 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35161

Sequence Viewer

Length: 246 bp
ATGGCACCTAAACTGAAGATGACAAAAAAAAGAAGGCTCTCAGAAGGTGATCATAGCTCAGCAGATTTGTGTCGTGCTGCAAGTTATAATGAAAGTTTATCAAGTGAGGGGAATATGCGAGAAATAAAGAATGATCAGACTTTTGTTGCGTCTATAGCAGAAAGTTCATTTTACGACGACAGCACACATGATCAAATCATGGCAAGAACAGGTCAGTTTCCTCTGAAGTTTCAAGTGATCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.11

Weight (kDa)

6.72

Isoelectric Point (pI)

52.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 87
AccB1I GGYRCC 1 cut(s) 4
AcuI CTGAAG 2 cut(s) 35, 245
AgsI TTSAA 1 cut(s) 233
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
ApeKI GCWGC 1 cut(s) 77
AsuHPI GGTGA 1 cut(s) 59
BanI GGYRCC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 64
BclI TGATCA 3 cut(s) 49, 133, 190
BfmI CTRYAG 1 cut(s) 153
BisI GCNGC 1 cut(s) 78
BlpI GCTNAGC 1 cut(s) 58
BlsI GCNGC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 6
Bpu1102I GCTNAGC 1 cut(s) 58
BseMII CTCAG 2 cut(s) 54, 72
BseXI GCAGC 1 cut(s) 64
BshNI GGYRCC 1 cut(s) 4
Bsp143I GATC 4 cut(s) 49, 133, 190, 237
Bsp1720I GCTNAGC 1 cut(s) 58
BspCNI CTCAG 2 cut(s) 53, 71
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 4 cut(s) 49, 133, 190, 237
BstDEI CTNAG 2 cut(s) 40, 58
BstKTI GATC 4 cut(s) 52, 136, 193, 240
BstMBI GATC 4 cut(s) 49, 133, 190, 237
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 153
BstV1I GCAGC 1 cut(s) 64
CseI GACGC 1 cut(s) 138
CviAII CATG 2 cut(s) 188, 199
CviJI RGCY 2 cut(s) 37, 57
CviKI_1 RGCY 2 cut(s) 37, 57
DdeI CTNAG 2 cut(s) 40, 58
DpnI GATC 4 cut(s) 51, 135, 192, 239
DpnII GATC 4 cut(s) 49, 133, 190, 237
Eco57I CTGAAG 2 cut(s) 35, 245
FaeI CATG 2 cut(s) 191, 202
FaiI YATR 7 cut(s) 54, 87, 116, 155, 189, 200, 244
FatI CATG 2 cut(s) 187, 198
FbaI TGATCA 3 cut(s) 49, 133, 190
Fnu4HI GCNGC 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 78
FspEI CC 9 cut(s) 19, 21, 30, 92, 93, 94, 185, 195, 234
GluI GCNGC 1 cut(s) 78
HgaI GACGC 1 cut(s) 138
Hin1II CATG 2 cut(s) 191, 202
HphI GGTGA 1 cut(s) 59
Hpy188I TCNGA 3 cut(s) 43, 138, 225
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 2 cut(s) 27, 38
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 2 cut(s) 40, 58
Hsp92II CATG 2 cut(s) 191, 202
Ksp22I TGATCA 3 cut(s) 49, 133, 190
Kzo9I GATC 4 cut(s) 49, 133, 190, 237
LpnPI CCDG 1 cut(s) 195
Lsp1109I GCAGC 1 cut(s) 64
MalI GATC 4 cut(s) 51, 135, 192, 239
MboI GATC 4 cut(s) 49, 133, 190, 237
MboII GAAGA 1 cut(s) 28
MnlI CCTC 2 cut(s) 100, 231
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 4 cut(s) 49, 133, 190, 237
NlaIII CATG 2 cut(s) 191, 202
NlaIV GGNNCC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 79
PsiI TTATAA 1 cut(s) 87
PspN4I GGNNCC 1 cut(s) 6
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 4 cut(s) 49, 133, 190, 237
SetI ASST 4 cut(s) 10, 49, 59, 214
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 8 cut(s) 86, 93, 114, 131, 200, 211, 216, 222
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 105, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.