Rh2AG410800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
60926231 .. 60943728
17498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG410800.1

Sequence Viewer

Length: 240 bp
ATGCGAGAAATAAAGAATGATCAGACTTTTTTGCATCTAGCAGAAAGTTCATTTCACGACGACAGCACACATGATCAAATCATGGCAAGAACAGAACAAAGTCGTAAACACAAACGGAAAAGATGTACATCTGCTATAAGTTTCAACTGTGGTGCAAGCACGTCCAACAATCTAGGAGTCGAGAAAGCTGCTTCACACGGAAATAATAAAGCAAATGTGGCAACTTTGCTTAAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.8

Weight (kDa)

9.44

Isoelectric Point (pI)

47.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 127
AgsI TTSAA 1 cut(s) 145
AjiI CACGTC 1 cut(s) 162
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 188
BbvI GCAGC 1 cut(s) 175
BcgI CGANNNNNNTGC 2 cut(s) 170, 204
BclI TGATCA 2 cut(s) 19, 73
BfaI CTAG 2 cut(s) 38, 173
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
BmgBI CACGTC 1 cut(s) 162
BmsI GCATC 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 127
Bse8I GATNNNNATC 1 cut(s) 127
BseJI GATNNNNATC 1 cut(s) 127
BseXI GCAGC 1 cut(s) 175
Bsp1407I TGTACA 1 cut(s) 125
Bsp143I GATC 2 cut(s) 19, 73
BsrGI TGTACA 1 cut(s) 125
BssMI GATC 2 cut(s) 19, 73
Bst4CI ACNGT 1 cut(s) 149
BstAUI TGTACA 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 157
BstKTI GATC 2 cut(s) 22, 76
BstMBI GATC 2 cut(s) 19, 73
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstV1I GCAGC 1 cut(s) 175
BtrI CACGTC 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 126
CviAII CATG 2 cut(s) 71, 82
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
CviQI GTAC 1 cut(s) 126
DpnI GATC 2 cut(s) 21, 75
DpnII GATC 2 cut(s) 19, 73
FaeI CATG 2 cut(s) 74, 85
FaiI YATR 3 cut(s) 72, 83, 137
FatI CATG 2 cut(s) 70, 81
FbaI TGATCA 2 cut(s) 19, 73
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
FspBI CTAG 2 cut(s) 38, 173
FspEI CC 7 cut(s) 68, 100, 135, 159, 178, 183, 203
GluI GCNGC 1 cut(s) 189
Hin1II CATG 2 cut(s) 74, 85
HinfI GANTC 1 cut(s) 177
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 2 cut(s) 56, 181
Hpy8I GTNNAC 1 cut(s) 107
Hpy99I CGWCG 1 cut(s) 62
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 161
HpyCH4V TGCA 2 cut(s) 34, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
HpySE526I ACGT 1 cut(s) 161
Hsp92II CATG 2 cut(s) 74, 85
Ksp22I TGATCA 2 cut(s) 19, 73
Kzo9I GATC 2 cut(s) 19, 73
Lsp1109I GCAGC 1 cut(s) 175
LweI GCATC 1 cut(s) 43
MaeI CTAG 2 cut(s) 38, 173
MaeII ACGT 1 cut(s) 161
MalI GATC 2 cut(s) 21, 75
MboI GATC 2 cut(s) 19, 73
MlyI GAGTC 1 cut(s) 186
MmeI TCCRAC 1 cut(s) 189
MseI TTAA 1 cut(s) 231
MwoI GCNNNNNNNGC 1 cut(s) 218
NdeII GATC 2 cut(s) 19, 73
NlaIII CATG 2 cut(s) 74, 85
PkrI GCNGC 1 cut(s) 190
PleI GAGTC 1 cut(s) 185
PpsI GAGTC 1 cut(s) 185
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 2 cut(s) 19, 73
SchI GAGTC 1 cut(s) 186
SetI ASST 2 cut(s) 164, 190
SfaNI GCATC 1 cut(s) 43
SspMI CTAG 2 cut(s) 38, 173
TaaI ACNGT 1 cut(s) 149
TaiI ACGT 1 cut(s) 164
TaqI TCGA 1 cut(s) 180
TatI WGTACW 1 cut(s) 125
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 1 cut(s) 39
TspGWI ACGGA 2 cut(s) 130, 213
XspI CTAG 2 cut(s) 38, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.