RchiOBHm_Chr4g0396941

F-box domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
13157574 .. 13157917
344 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36931

Sequence Viewer

Length: 276 bp
ATGAATCTTGATTACTTGAGAGCTGCATTGTGCGGTAGGTATCAGATTCCCAGCCATAGGTTTGAGGCCTGGATTTTGAGTGTTGTTCCTGGTGCGAACAAAGAGGTGCCAGAAGTTGTGTTGCTGGTGTTTGGTATGGTTGTTTCCTACAATTTGAAAAATGGAACCCTTAAGAAACTTATGGGTTTGGTTCCTTGTCAAGAGGCTGCTGTTCATAATATAAAGTGTCATTGGTACAGTGTGTTTCCATTCATACAAACTCTCTCTCCCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.28

Weight (kDa)

8.91

Isoelectric Point (pI)

38.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018188)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 106
AciI CCGC 1 cut(s) 33
AfaI GTAC 1 cut(s) 236
AfiI CCNNNNNNNGG 1 cut(s) 57
AflII CTTAAG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 157
AjnI CCWGG 2 cut(s) 68, 88
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AoxI GGCC 1 cut(s) 66
ApeKI GCWGC 2 cut(s) 23, 206
BanI GGYRCC 1 cut(s) 106
BbvI GCAGC 2 cut(s) 10, 193
BciT130I CCWGG 2 cut(s) 70, 90
BfrI CTTAAG 1 cut(s) 170
BisI GCNGC 2 cut(s) 24, 207
BlsI GCNGC 2 cut(s) 25, 208
Bme1390I CCNGG 2 cut(s) 70, 90
BmiI GGNNCC 3 cut(s) 108, 166, 192
BmrFI CCNGG 2 cut(s) 70, 90
BpuEI CTTGAG 1 cut(s) 37
BsaXI ACNNNNNCTCC 1 cut(s) 250
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseBI CCWGG 2 cut(s) 70, 90
BseLI CCNNNNNNNGG 1 cut(s) 57
BseXI GCAGC 2 cut(s) 10, 193
BseYI CCCAGC 1 cut(s) 50
BshFI GGCC 1 cut(s) 68
BshNI GGYRCC 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 57
BsnI GGCC 1 cut(s) 68
BspACI CCGC 1 cut(s) 33
BspANI GGCC 1 cut(s) 68
BspLI GGNNCC 3 cut(s) 108, 166, 192
BspT107I GGYRCC 1 cut(s) 106
BspTI CTTAAG 1 cut(s) 170
Bst2UI CCWGG 2 cut(s) 70, 90
Bst4CI ACNGT 1 cut(s) 239
BstAFI CTTAAG 1 cut(s) 170
BstNI CCWGG 2 cut(s) 70, 90
BstSCI CCNGG 2 cut(s) 68, 88
BstV1I GCAGC 2 cut(s) 10, 193
BsuRI GGCC 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 244
Csp6I GTAC 1 cut(s) 235
CviJI RGCY 4 cut(s) 23, 54, 68, 206
CviKI_1 RGCY 4 cut(s) 23, 54, 68, 206
CviQI GTAC 1 cut(s) 235
Eco147I AGGCCT 1 cut(s) 68
EcoRII CCWGG 2 cut(s) 68, 88
FaiI YATR 8 cut(s) 57, 137, 182, 216, 221, 254, 272, 274
FauNDI CATATG 1 cut(s) 272
Fnu4HI GCNGC 2 cut(s) 24, 207
Fsp4HI GCNGC 2 cut(s) 24, 207
GluI GCNGC 2 cut(s) 24, 207
GsaI CCCAGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 68
HinfI GANTC 2 cut(s) 4, 46
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 2 cut(s) 8, 200
HpyCH4III ACNGT 1 cut(s) 239
HpyCH4V TGCA 1 cut(s) 26
LpnPI CCDG 7 cut(s) 55, 64, 75, 82, 102, 110, 123
Lsp1109I GCAGC 2 cut(s) 10, 193
MluCI AATT 1 cut(s) 151
MnlI CCTC 3 cut(s) 58, 97, 196
MseI TTAA 1 cut(s) 171
MspCI CTTAAG 1 cut(s) 170
MspR9I CCNGG 2 cut(s) 70, 90
MvaI CCWGG 2 cut(s) 70, 90
NdeI CATATG 1 cut(s) 272
NlaIV GGNNCC 3 cut(s) 108, 166, 192
PceI AGGCCT 1 cut(s) 68
PfeI GAWTC 2 cut(s) 4, 46
PkrI GCNGC 2 cut(s) 25, 208
Psp6I CCWGG 2 cut(s) 68, 88
PspFI CCCAGC 1 cut(s) 50
PspGI CCWGG 2 cut(s) 68, 88
PspN4I GGNNCC 3 cut(s) 108, 166, 192
RsaI GTAC 1 cut(s) 236
RsaNI GTAC 1 cut(s) 235
SaqAI TTAA 1 cut(s) 171
SatI GCNGC 2 cut(s) 24, 207
ScrFI CCNGG 2 cut(s) 70, 90
SetI ASST 4 cut(s) 25, 41, 62, 108
SmlI CTYRAG 2 cut(s) 16, 170
SmoI CTYRAG 2 cut(s) 16, 170
Sse9I AATT 1 cut(s) 151
SseBI AGGCCT 1 cut(s) 68
SsiI CCGC 1 cut(s) 33
StuI AGGCCT 1 cut(s) 68
StyD4I CCNGG 2 cut(s) 68, 88
TaaI ACNGT 1 cut(s) 239
TasI AATT 1 cut(s) 151
TfiI GAWTC 2 cut(s) 4, 46
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TscAI CASTG 1 cut(s) 244
TseI GCWGC 2 cut(s) 23, 206
TspDTI ATGAA 3 cut(s) 17, 203, 241
TspRI CASTG 1 cut(s) 244
Vha464I CTTAAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.