Rh4AG111800

F-box domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
24210136 .. 24210435
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG111800.1

Sequence Viewer

Length: 300 bp
ATGCCTCCATATCTGACCAATTTCGGTGTCCCAAAAATCAAGATCTTACAATCCTGTAATGGGTTGCTTCTATCTGGCTTTGGATCCTTCCCATTCCACTCCACTTCAAACTGGTGTGCATTATTGCAACCATTAATCTTGGACATCTATGATTCTCAGACCAACGCTTGGAACACTTCCCCGATAAACTTGAAACCACCTGAAAAAACATCCTTCGATGCTGTTGAGTTTTGCAGGCGTGCAATTCACTGGTATAGTTATGAACAGACCTCCACTTACTTTGATGTGGAGAAAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.37

Weight (kDa)

5.57

Isoelectric Point (pI)

56.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018188)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 168
AclWI GGATC 2 cut(s) 78, 91
AfiI CCNNNNNNNGG 2 cut(s) 60, 168
AgsI TTSAA 2 cut(s) 108, 193
AlwI GGATC 2 cut(s) 78, 91
AseI ATTAAT 1 cut(s) 134
BamHI GGATCC 1 cut(s) 83
BglII AGATCT 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 85
BmsI GCATC 1 cut(s) 208
BsaXI ACNNNNNCTCC 1 cut(s) 281
Bsc4I CCNNNNNNNGG 2 cut(s) 60, 168
Bse1I ACTGG 2 cut(s) 116, 254
BseGI GGATG 1 cut(s) 209
BseLI CCNNNNNNNGG 2 cut(s) 60, 168
BseMII CTCAG 1 cut(s) 170
BseNI ACTGG 2 cut(s) 116, 254
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 2 cut(s) 60, 168
BsmFI GGGAC 1 cut(s) 14
Bsp143I GATC 2 cut(s) 42, 83
BspCNI CTCAG 1 cut(s) 169
BspLI GGNNCC 1 cut(s) 85
BspPI GGATC 2 cut(s) 78, 91
BsrI ACTGG 2 cut(s) 116, 254
BssMI GATC 2 cut(s) 42, 83
BstC8I GCNNGC 2 cut(s) 236, 240
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 209
BstKTI GATC 2 cut(s) 45, 86
BstMBI GATC 2 cut(s) 42, 83
BstX2I RGATCY 2 cut(s) 42, 83
BstYI RGATCY 2 cut(s) 42, 83
BtsCI GGATG 1 cut(s) 209
BtsIMutI CAGTG 1 cut(s) 247
Cac8I GCNNGC 2 cut(s) 236, 240
CspCI CAANNNNNGTGG 2 cut(s) 262, 297
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
DdeI CTNAG 1 cut(s) 156
DpnI GATC 2 cut(s) 44, 85
DpnII GATC 2 cut(s) 42, 83
FaiI YATR 4 cut(s) 10, 150, 255, 261
FaqI GGGAC 1 cut(s) 14
FokI GGATG 1 cut(s) 196
HinfI GANTC 1 cut(s) 152
Hpy188I TCNGA 2 cut(s) 15, 159
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 2 cut(s) 97, 223
HpyCH4V TGCA 4 cut(s) 119, 127, 234, 242
HpyF3I CTNAG 1 cut(s) 156
Kzo9I GATC 2 cut(s) 42, 83
LpnPI CCDG 6 cut(s) 60, 67, 97, 213, 220, 235
LweI GCATC 1 cut(s) 208
MalI GATC 2 cut(s) 44, 85
MboI GATC 2 cut(s) 42, 83
MflI RGATCY 2 cut(s) 42, 83
MluCI AATT 2 cut(s) 19, 243
MnlI CCTC 2 cut(s) 15, 280
MseI TTAA 1 cut(s) 134
NdeII GATC 2 cut(s) 42, 83
NlaIV GGNNCC 1 cut(s) 85
PfeI GAWTC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 168
PshBI ATTAAT 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 85
PsuI RGATCY 2 cut(s) 42, 83
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 2 cut(s) 42, 83
SetI ASST 2 cut(s) 202, 272
SfaNI GCATC 1 cut(s) 208
Sse9I AATT 2 cut(s) 19, 243
TaqI TCGA 1 cut(s) 216
TasI AATT 2 cut(s) 19, 243
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 1 cut(s) 254
TspDTI ATGAA 1 cut(s) 276
TspRI CASTG 1 cut(s) 254
Van91I CCANNNNNTGG 1 cut(s) 168
VspI ATTAAT 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.