RchiOBHm_Chr5g0014311

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0017750
Physical Location & Seq
Reverse (-)
9794947 .. 9795934
988 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29476

Sequence Viewer

Length: 192 bp
ATGAGTCCCAGACCAAAGACTCCCAAGGCCCCCAAACCCAGTAATCCAAAACCCGCCAAAGTTTTTAGCGCCTATATCAAACTAGCAGGATCAAACGGCTTCCTTGGCCAAAACGACGACGTCTTCAGCTCCGCCACGACCTTCTCCAGCAGCATCCCGCTGATTTCCGGCGCCGGAATATGGCTAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.57

Weight (kDa)

10.12

Isoelectric Point (pI)

35.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017750)

Species Orthologous Gene IDs
prunus_persica Prupe.4G081800_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0014311
rosa_laevigata RLG00000032097
rosa_multiflora Rmu_sc0009295.1_g000004
rosa_roxburghii Rroxscaffold_1G00062270
rosa_rugosa Rorug05G0017100 Rorug05G0017200 Rorug05G0017300
rosa_samantha Rh5AG111300 Rh5BG108600 Rh5CG120300 Rh5DG107300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 123
AccB1I GGYRCC 1 cut(s) 170
AciI CCGC 3 cut(s) 54, 132, 158
AclWI GGATC 1 cut(s) 97
AcoI YGGCCR 1 cut(s) 106
AcuI CTGAAG 1 cut(s) 109
AcyI GRCGYC 2 cut(s) 120, 171
AfiI CCNNNNNNNGG 1 cut(s) 180
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
AlwI GGATC 1 cut(s) 97
AoxI GGCC 2 cut(s) 27, 106
ApeKI GCWGC 1 cut(s) 150
AspLEI GCGC 2 cut(s) 71, 173
AspS9I GGNCC 1 cut(s) 28
BalI TGGCCA 1 cut(s) 108
BanI GGYRCC 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 115
BbvI GCAGC 1 cut(s) 162
BceAI ACGGC 1 cut(s) 112
BfaI CTAG 1 cut(s) 83
BfoI RGCGCY 2 cut(s) 72, 174
BisI GCNGC 1 cut(s) 151
BlsI GCNGC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 2 cut(s) 30, 172
BmrI ACTGGG 1 cut(s) 33
BmsI GCATC 1 cut(s) 162
BmuI ACTGGG 1 cut(s) 33
BpiI GAAGAC 1 cut(s) 115
BpmI CTGGAG 1 cut(s) 130
BsaHI GRCGYC 2 cut(s) 120, 171
BsaJI CCNNGG 2 cut(s) 24, 103
Bsc4I CCNNNNNNNGG 1 cut(s) 180
Bse1I ACTGG 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 24, 103
BseGI GGATG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 180
BseNI ACTGG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 162
BshFI GGCC 2 cut(s) 29, 108
BshNI GGYRCC 1 cut(s) 170
BsiSI CCGG 2 cut(s) 168, 174
BslI CCNNNNNNNGG 1 cut(s) 180
BsnI GGCC 2 cut(s) 29, 108
Bsp143I GATC 1 cut(s) 89
BspACI CCGC 3 cut(s) 54, 132, 158
BspANI GGCC 2 cut(s) 29, 108
BspLI GGNNCC 2 cut(s) 30, 172
BspPI GGATC 1 cut(s) 97
BspT107I GGYRCC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 2 cut(s) 24, 103
BssMI GATC 1 cut(s) 89
BssNI GRCGYC 2 cut(s) 120, 171
BssT1I CCWWGG 2 cut(s) 24, 103
BstACI GRCGYC 2 cut(s) 120, 171
BstDEI CTNAG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 153
BstH2I RGCGCY 2 cut(s) 72, 174
BstHHI GCGC 2 cut(s) 71, 173
BstKTI GATC 1 cut(s) 92
BstMBI GATC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 162
BstV2I GAAGAC 1 cut(s) 115
BsuRI GGCC 2 cut(s) 29, 108
BtsCI GGATG 1 cut(s) 153
CfoI GCGC 2 cut(s) 71, 173
Cfr13I GGNCC 1 cut(s) 28
CviJI RGCY 5 cut(s) 29, 99, 108, 129, 184
CviKI_1 RGCY 5 cut(s) 29, 99, 108, 129, 184
DdeI CTNAG 1 cut(s) 185
DinI GGCGCC 1 cut(s) 172
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
EaeI YGGCCR 1 cut(s) 106
EciI GGCGGA 1 cut(s) 121
Eco130I CCWWGG 2 cut(s) 24, 103
Eco57I CTGAAG 1 cut(s) 109
EcoO109I RGGNCCY 1 cut(s) 28
EcoT14I CCWWGG 2 cut(s) 24, 103
EgeI GGCGCC 1 cut(s) 172
EheI GGCGCC 1 cut(s) 172
ErhI CCWWGG 2 cut(s) 24, 103
FaiI YATR 2 cut(s) 75, 181
FauI CCCGC 2 cut(s) 61, 165
Fnu4HI GCNGC 1 cut(s) 151
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 151
FspBI CTAG 1 cut(s) 83
GlaI GCGC 2 cut(s) 70, 172
GluI GCNGC 1 cut(s) 151
GsuI CTGGAG 1 cut(s) 130
HaeII RGCGCY 2 cut(s) 72, 174
HaeIII GGCC 2 cut(s) 29, 108
HapII CCGG 2 cut(s) 168, 174
HhaI GCGC 2 cut(s) 71, 173
Hin1I GRCGYC 2 cut(s) 120, 171
Hin6I GCGC 2 cut(s) 69, 171
HinP1I GCGC 2 cut(s) 69, 171
HinfI GANTC 2 cut(s) 4, 19
HpaII CCGG 2 cut(s) 168, 174
Hpy99I CGWCG 2 cut(s) 119, 122
HpyAV CCTTC 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 185
HpySE526I ACGT 1 cut(s) 120
Hsp92I GRCGYC 2 cut(s) 120, 171
HspAI GCGC 2 cut(s) 69, 171
KasI GGCGCC 1 cut(s) 170
Kzo9I GATC 1 cut(s) 89
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 6 cut(s) 22, 52, 72, 160, 181, 187
Lsp1109I GCAGC 1 cut(s) 162
LweI GCATC 1 cut(s) 162
MaeI CTAG 1 cut(s) 83
MaeII ACGT 1 cut(s) 120
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MboII GAAGA 1 cut(s) 115
MlsI TGGCCA 1 cut(s) 108
MluNI TGGCCA 1 cut(s) 108
Mly113I GGCGCC 1 cut(s) 171
MlyI GAGTC 2 cut(s) 13, 13
Mox20I TGGCCA 1 cut(s) 108
MscI TGGCCA 1 cut(s) 108
Msp20I TGGCCA 1 cut(s) 108
MspA1I CMGCKG 1 cut(s) 160
MspI CCGG 2 cut(s) 168, 174
MwoI GCNNNNNNNGC 1 cut(s) 105
NarI GGCGCC 1 cut(s) 171
NdeII GATC 1 cut(s) 89
NlaIV GGNNCC 2 cut(s) 30, 172
PflFI GACNNNGTC 1 cut(s) 119
PkrI GCNGC 1 cut(s) 152
PleI GAGTC 2 cut(s) 12, 13
PluTI GGCGCC 1 cut(s) 174
PpsI GAGTC 2 cut(s) 12, 13
PspN4I GGNNCC 2 cut(s) 30, 172
PspPI GGNCC 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 119
SatI GCNGC 1 cut(s) 151
Sau3AI GATC 1 cut(s) 89
Sau96I GGNCC 1 cut(s) 28
SchI GAGTC 2 cut(s) 13, 13
SetI ASST 3 cut(s) 123, 131, 143
SfaNI GCATC 1 cut(s) 162
SfoI GGCGCC 1 cut(s) 172
SsiI CCGC 3 cut(s) 54, 132, 158
SspDI GGCGCC 1 cut(s) 170
SspMI CTAG 1 cut(s) 83
StyI CCWWGG 2 cut(s) 24, 103
TaiI ACGT 1 cut(s) 123
TseI GCWGC 1 cut(s) 150
Tth111I GACNNNGTC 1 cut(s) 119
XspI CTAG 1 cut(s) 83
ZraI GACGTC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.