RchiOBHm_Chr5g0049911

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
48040645 .. 48040920
276 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32754

Sequence Viewer

Length: 276 bp
ATGAGGTCTGGGCATGGCGGATTTATCACTGTAAAGAATACCCTTCTGCATTGTTATTATGTTTGTGGGAAAATTGAGGATGCCCACCACTTGTTCGATGAATTTCCTCAGAGAAATGATTTGATTTCATGGAATACTTTGATGGGTGATTACCTTCATGTTTCACAACCTCGTGTGATTGTGGACTTGTTTAAGGAAATGTGCATCGGTGGTTTTGAAGCTAGTGTAATCATTGTTCTGTATCTTTTATCAGCCATTGGTGAGTTGGGAAGTTAG

Protein Analysis

91

Amino Acids

10.24

Weight (kDa)

5.59

Isoelectric Point (pI)

24.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 101
AgsI TTSAA 1 cut(s) 218
AluBI AGCT 1 cut(s) 221
AluI AGCT 1 cut(s) 221
ApoI RAATTY 1 cut(s) 101
AsuHPI GGTGA 2 cut(s) 158, 272
BauI CACGAG 1 cut(s) 171
BccI CCATC 1 cut(s) 136
BfaI CTAG 1 cut(s) 222
BmsI GCATC 2 cut(s) 70, 213
BseGI GGATG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 122
BspACI CCGC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 121
BssSI CACGAG 1 cut(s) 171
Bst2BI CACGAG 1 cut(s) 171
Bst4CI ACNGT 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 85
BtsCI GGATG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 27
CviAII CATG 3 cut(s) 14, 129, 158
CviJI RGCY 2 cut(s) 221, 254
CviKI_1 RGCY 2 cut(s) 221, 254
DdeI CTNAG 1 cut(s) 108
EciI GGCGGA 1 cut(s) 33
FaeI CATG 3 cut(s) 17, 132, 161
FaiI YATR 4 cut(s) 15, 60, 130, 159
FatI CATG 3 cut(s) 13, 128, 157
FokI GGATG 1 cut(s) 92
FspBI CTAG 1 cut(s) 222
Hin1II CATG 3 cut(s) 17, 132, 161
HphI GGTGA 2 cut(s) 158, 272
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 1 cut(s) 111
Hpy8I GTNNAC 1 cut(s) 184
HpyAV CCTTC 2 cut(s) 53, 164
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 49, 204
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 3 cut(s) 17, 132, 161
LweI GCATC 2 cut(s) 70, 213
MaeI CTAG 1 cut(s) 222
MluCI AATT 2 cut(s) 72, 101
MnlI CCTC 3 cut(s) 70, 117, 180
MseI TTAA 1 cut(s) 192
NlaIII CATG 3 cut(s) 17, 132, 161
PsrI GAACNNNNNNTAC 2 cut(s) 219, 251
SaqAI TTAA 1 cut(s) 192
SetI ASST 4 cut(s) 8, 156, 172, 223
SfaNI GCATC 2 cut(s) 70, 213
SgeI CNNG 9 cut(s) 21, 26, 103, 141, 170, 183, 185, 199, 234
Sse9I AATT 2 cut(s) 72, 101
SsiI CCGC 1 cut(s) 18
SspMI CTAG 1 cut(s) 222
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 72, 101
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 3 cut(s) 114, 117, 146
TspRI CASTG 1 cut(s) 34
XapI RAATTY 1 cut(s) 101
XcmI CCANNNNNNNNNTGG 1 cut(s) 262
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.