RchiOBHm_Chr5g0055221

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
58108726 .. 58118407
9682 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33226

Sequence Viewer

Length: 165 bp
ATGACATTTGCTAAGGTACGTAATAGGGTCAAATGGGTCTGCCCACCATCTGATAGGCACAAAGTGAACTTTGATGGGGCCTTCAGGCCGGGTTGTAGAGGTGGTCTGGGTGTGGTTCGGCTTTGTTATCCGACAGGAACAATAATTATTTCCGTTAATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.04

Weight (kDa)

10.44

Isoelectric Point (pI)

24.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 67
AdeI CACNNNGTG 1 cut(s) 64
AfaI GTAC 1 cut(s) 18
AoxI GGCC 2 cut(s) 78, 86
AspS9I GGNCC 1 cut(s) 78
AsuC2I CCSGG 1 cut(s) 90
BccI CCATC 2 cut(s) 55, 68
BcnI CCSGG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 78
BmiI GGNNCC 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 90
Bpu10I CCTNAGC 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 90
BsaAI YACGTR 1 cut(s) 20
BshFI GGCC 2 cut(s) 80, 88
BsiSI CCGG 1 cut(s) 89
BsnI GGCC 2 cut(s) 80, 88
BspANI GGCC 2 cut(s) 80, 88
BspLI GGNNCC 1 cut(s) 79
BstBAI YACGTR 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 88
BstSNI TACGTA 1 cut(s) 20
BsuRI GGCC 2 cut(s) 80, 88
Cfr13I GGNCC 1 cut(s) 78
Csp6I GTAC 1 cut(s) 17
CviJI RGCY 3 cut(s) 80, 88, 121
CviKI_1 RGCY 3 cut(s) 80, 88, 121
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 1 cut(s) 12
DraIII CACNNNGTG 1 cut(s) 64
Eco105I TACGTA 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 67
EcoO109I RGGNCCY 1 cut(s) 78
HaeIII GGCC 2 cut(s) 80, 88
HapII CCGG 1 cut(s) 89
HpaII CCGG 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 52, 132
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 91
HpyCH4IV ACGT 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 19
LpnPI CCDG 4 cut(s) 70, 92, 102, 120
MaeII ACGT 1 cut(s) 19
MluCI AATT 2 cut(s) 144, 157
MmeI TCCRAC 1 cut(s) 155
MnlI CCTC 1 cut(s) 92
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 90
NciI CCSGG 1 cut(s) 90
NlaIV GGNNCC 1 cut(s) 79
Ppu21I YACGTR 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 79
PspPI GGNCC 1 cut(s) 78
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SaqAI TTAA 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 90
SetI ASST 3 cut(s) 18, 22, 103
SgeI CNNG 5 cut(s) 97, 101, 102, 119, 147
SnaBI TACGTA 1 cut(s) 20
Sse9I AATT 2 cut(s) 144, 157
StyD4I CCNGG 1 cut(s) 88
TaiI ACGT 1 cut(s) 22
TasI AATT 2 cut(s) 144, 157
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspGWI ACGGA 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.