Rorug01G0049200

Cell division

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
8142456 .. 8143528
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0049200.1

Sequence Viewer

Length: 366 bp
ATGGAGCATGTGATACAAGGAGTCTATGGGATTGGCGTGGTCTTTAGGGATGAACACAGAGGTTTGAAGGGAGCCATAGCTATTCCTCAAGTTGAAAATCTATCACTAAGATCTATTGAGGCTCTTGCACTACTTCATGGACTTCAGTTTGCTATTCATGTTGGATTCAAAAACCTGGAGATTAAAGGCAAGGTCAAAGATGTAACTAGAGTTCAAACACTTCTCTTCAGCGCAACCTTACCCTCTTGGGGGCAAAATATTTCCAGAAGGTTCCTTAAATCAGATAAGGAAACTACAGATCTGGTTGGTAATGAAAAGATGAAGGCCAGCATCAATGTTAGGCATATTGTTCTTCCCTATGCTTAA

Protein Analysis

121

Amino Acids

13.49

Weight (kDa)

9.75

Isoelectric Point (pI)

31.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 10 - 70 4e-06 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 128, 211
AfiI CCNNNNNNNGG 2 cut(s) 248, 249
AgsI TTSAA 4 cut(s) 67, 95, 169, 215
AjnI CCWGG 1 cut(s) 174
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AoxI GGCC 1 cut(s) 324
AspLEI GCGC 1 cut(s) 233
BciT130I CCWGG 1 cut(s) 176
BfaI CTAG 1 cut(s) 207
BfmI CTRYAG 1 cut(s) 294
BglII AGATCT 2 cut(s) 110, 298
Bme1390I CCNGG 1 cut(s) 176
BmiI GGNNCC 2 cut(s) 73, 272
BmrFI CCNGG 1 cut(s) 176
BmsI GCATC 1 cut(s) 339
BpmI CTGGAG 1 cut(s) 197
BpuEI CTTGAG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 2 cut(s) 248, 249
BseBI CCWGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 2 cut(s) 248, 249
BshFI GGCC 1 cut(s) 326
BslI CCNNNNNNNGG 2 cut(s) 248, 249
BsnI GGCC 1 cut(s) 326
Bsp143I GATC 2 cut(s) 110, 298
BspANI GGCC 1 cut(s) 326
BspLI GGNNCC 2 cut(s) 73, 272
BssMI GATC 2 cut(s) 110, 298
Bst2UI CCWGG 1 cut(s) 176
Bst6I CTCTTC 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 328
BstDEI CTNAG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 55
BstHHI GCGC 1 cut(s) 233
BstKTI GATC 2 cut(s) 113, 301
BstMBI GATC 2 cut(s) 110, 298
BstNI CCWGG 1 cut(s) 176
BstNSI RCATGY 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 174
BstSFI CTRYAG 1 cut(s) 294
BstX2I RGATCY 2 cut(s) 110, 298
BstYI RGATCY 2 cut(s) 110, 298
BsuRI GGCC 1 cut(s) 326
BtsCI GGATG 1 cut(s) 55
Cac8I GCNNGC 1 cut(s) 328
CfoI GCGC 1 cut(s) 233
CviAII CATG 3 cut(s) 8, 137, 158
CviJI RGCY 4 cut(s) 74, 80, 122, 326
CviKI_1 RGCY 4 cut(s) 74, 80, 122, 326
DdeI CTNAG 1 cut(s) 107
DpnI GATC 2 cut(s) 112, 300
DpnII GATC 2 cut(s) 110, 298
Eam1104I CTCTTC 1 cut(s) 230
EarI CTCTTC 1 cut(s) 230
Eco57I CTGAAG 2 cut(s) 128, 211
EcoRII CCWGG 1 cut(s) 174
FaeI CATG 3 cut(s) 11, 140, 161
FaiI YATR 7 cut(s) 9, 27, 77, 138, 159, 345, 360
FatI CATG 3 cut(s) 7, 136, 157
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 207
GlaI GCGC 1 cut(s) 232
GsuI CTGGAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 326
HhaI GCGC 1 cut(s) 233
Hin1II CATG 3 cut(s) 11, 140, 161
Hin6I GCGC 1 cut(s) 231
HinP1I GCGC 1 cut(s) 231
HinfI GANTC 2 cut(s) 21, 165
Hpy188I TCNGA 1 cut(s) 283
Hpy188III TCNNGA 1 cut(s) 264
HpyAV CCTTC 3 cut(s) 61, 261, 316
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 3 cut(s) 11, 140, 161
HspAI GCGC 1 cut(s) 231
Kzo9I GATC 2 cut(s) 110, 298
LmnI GCTCC 2 cut(s) 4, 71
LpnPI CCDG 5 cut(s) 161, 188, 277, 287, 340
LweI GCATC 1 cut(s) 339
MaeI CTAG 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 202
MalI GATC 2 cut(s) 112, 300
MboI GATC 2 cut(s) 110, 298
MboII GAAGA 2 cut(s) 217, 344
MflI RGATCY 2 cut(s) 110, 298
MlyI GAGTC 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 4 cut(s) 53, 96, 112, 253
MseI TTAA 3 cut(s) 183, 276, 364
MspR9I CCNGG 1 cut(s) 176
MvaI CCWGG 1 cut(s) 176
NdeII GATC 2 cut(s) 110, 298
NlaIII CATG 3 cut(s) 11, 140, 161
NlaIV GGNNCC 2 cut(s) 73, 272
NspI RCATGY 1 cut(s) 11
PfeI GAWTC 1 cut(s) 165
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 174
PspGI CCWGG 1 cut(s) 174
PspN4I GGNNCC 2 cut(s) 73, 272
PsrI GAACNNNNNNTAC 2 cut(s) 195, 227
PsuI RGATCY 2 cut(s) 110, 298
SaqAI TTAA 3 cut(s) 183, 276, 364
Sau3AI GATC 2 cut(s) 110, 298
SchI GAGTC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 176
SetI ASST 6 cut(s) 64, 82, 177, 195, 239, 272
SfaNI GCATC 1 cut(s) 339
SfcI CTRYAG 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 87
SmoI CTYRAG 1 cut(s) 87
SspI AATATT 1 cut(s) 259
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 174
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 3 cut(s) 183, 276, 364
Tru9I TTAA 3 cut(s) 183, 276, 364
TspDTI ATGAA 5 cut(s) 66, 125, 146, 327, 335
XceI RCATGY 1 cut(s) 11
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.