Rroxscaffold_6G00402920

Purple acid phosphatase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
25393615 .. 25397073
3459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00402920.1

Sequence Viewer

Length: 198 bp
ATGTGGAATGAGATGACTGTAACATGGACAAGTGGATATGCTCTAGGGGAAGCAACACCTTTTGTTGAATGGCGTCAGAAAGGAGGAGAGCTTGTGAGATCCCTAGCCAGGACTTTGACCTTCGATAGCAACAGCATGTGTGTGCGGTTAAAGCTTTCAATGTTGAAACGGGTAGGGTTAACAAAGTGTCCAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

65

Amino Acids

7.44

Weight (kDa)

9.89

Isoelectric Point (pI)

23.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AclWI GGATC 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 3 cut(s) 68, 159, 166
AjnI CCWGG 1 cut(s) 107
AluBI AGCT 2 cut(s) 91, 154
AluI AGCT 2 cut(s) 91, 154
AlwI GGATC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 109
BfaI CTAG 2 cut(s) 44, 104
Bme1390I CCNGG 1 cut(s) 109
BmrFI CCNGG 1 cut(s) 109
BsaHI GRCGYC 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 191
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 191
BseLI CCNNNNNNNGG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 108
Bsp143I GATC 1 cut(s) 98
BspACI CCGC 1 cut(s) 145
BspPI GGATC 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 191
BssMI GATC 1 cut(s) 98
BssNI GRCGYC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 191
Bst2UI CCWGG 1 cut(s) 109
Bst4CI ACNGT 1 cut(s) 19
BstACI GRCGYC 1 cut(s) 73
BstKTI GATC 1 cut(s) 101
BstMBI GATC 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 109
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 98
BstYI RGATCY 1 cut(s) 98
CseI GACGC 1 cut(s) 62
CviAII CATG 2 cut(s) 24, 136
CviJI RGCY 3 cut(s) 91, 107, 154
CviKI_1 RGCY 3 cut(s) 91, 107, 154
DpnI GATC 1 cut(s) 100
DpnII GATC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 191
ErhI CCWWGG 1 cut(s) 191
FaeI CATG 2 cut(s) 27, 139
FaiI YATR 3 cut(s) 25, 39, 137
FatI CATG 2 cut(s) 23, 135
FspBI CTAG 2 cut(s) 44, 104
HgaI GACGC 1 cut(s) 62
Hin1I GRCGYC 1 cut(s) 73
Hin1II CATG 2 cut(s) 27, 139
HincII GTYRAC 1 cut(s) 180
HindII GTYRAC 1 cut(s) 180
HindIII AAGCTT 1 cut(s) 152
HpaI GTTAAC 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 180
Hpy188I TCNGA 1 cut(s) 78
Hpy8I GTNNAC 1 cut(s) 180
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
Hsp92I GRCGYC 1 cut(s) 73
Hsp92II CATG 2 cut(s) 27, 139
KspAI GTTAAC 1 cut(s) 180
Kzo9I GATC 1 cut(s) 98
LpnPI CCDG 2 cut(s) 94, 121
MaeI CTAG 2 cut(s) 44, 104
MaeIII GTNAC 1 cut(s) 19
MalI GATC 1 cut(s) 100
MboI GATC 1 cut(s) 98
MflI RGATCY 1 cut(s) 98
MnlI CCTC 1 cut(s) 77
MseI TTAA 2 cut(s) 149, 179
MslI CAYNNNNRTG 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 109
MvaI CCWGG 1 cut(s) 109
MwoI GCNNNNNNNGC 1 cut(s) 151
NdeII GATC 1 cut(s) 98
NlaIII CATG 2 cut(s) 27, 139
NspI RCATGY 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 107
PspGI CCWGG 1 cut(s) 107
PsuI RGATCY 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 2 cut(s) 149, 179
Sau3AI GATC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 109
SetI ASST 5 cut(s) 61, 93, 122, 156, 197
SgeI CNNG 9 cut(s) 36, 42, 56, 104, 116, 120, 121, 148, 182
SmiMI CAYNNNNRTG 1 cut(s) 140
SsiI CCGC 1 cut(s) 145
SspMI CTAG 2 cut(s) 44, 104
StyD4I CCNGG 1 cut(s) 107
StyI CCWWGG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 123
Tru1I TTAA 2 cut(s) 149, 179
Tru9I TTAA 2 cut(s) 149, 179
XceI RCATGY 1 cut(s) 139
XspI CTAG 2 cut(s) 44, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.