RLG00000000693

Membrane-anchored ubiquitin-fold protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0016524
Physical Location & Seq
Reverse (-)
3962328 .. 3964157
1830 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000693

Sequence Viewer

Length: 357 bp
ATGGCAACCCAAGATTTGGTTGAGGTCAAATTCAGATTATCCGATGGCACCGACATAGGTCCTCACAAGTATAGCCCAGCTGCTACTGTAGCATCACTCAAAGAGAAAATACTTACACAATGGCCCAAAGAGAAAGAAAATGGTCCAAGGACGATAAATGATTTGAAGCTTATTAATGCGGGAAAGATACTGGAAAACAACAGGACACTTGCTGATTCTAGACTTCCAGTTGGTGAACTCCCAGGAGGTCTCATCACTATGCATGTGGTTGTGCGTATTCCTGTTGCAGACAAAAAGAGTGATAAATTGCAGAATGATTCACCAGAGACACCTCGATGTTCATGCACAATATTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

119

Amino Acids

12.96

Weight (kDa)

8.6

Isoelectric Point (pI)

41.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 116 1.3e-43 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016524)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G22050
fragaria_vesca FvH4_5g38170
malus_domestica MD08G1176300.v1.1 MD15G1362100.v1.1
prunus_persica Prupe.1G510100_v2.0.a1
pyrus_communis pycom08g15130 pycom15g32470
rosa_chinensis RchiOBHm_Chr7g0240171
rosa_laevigata RLG00000000693
rosa_multiflora Rmu_sc0005008.1_g000005
rosa_roxburghii Rroxscaffold_3G00220350
rosa_rugosa Rorug07G0333900
rosa_samantha Rh7CG504200
rosa_wichuraiana Rw7G040850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 47
AccB7I CCANNNNNTGG 1 cut(s) 16
AciI CCGC 1 cut(s) 179
AcsI RAATTY 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 16
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 2 cut(s) 80, 169
AluI AGCT 2 cut(s) 80, 169
Alw26I GTCTC 2 cut(s) 254, 320
AoxI GGCC 1 cut(s) 122
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 29
AseI ATTAAT 1 cut(s) 174
AspS9I GGNCC 3 cut(s) 59, 123, 143
AsuHPI GGTGA 2 cut(s) 245, 312
AvaII GGWCC 2 cut(s) 59, 143
BanI GGYRCC 1 cut(s) 47
BbvI GCAGC 1 cut(s) 67
BccI CCATC 1 cut(s) 38
BcgI CGANNNNNNTGC 1 cut(s) 324
BciT130I CCWGG 1 cut(s) 243
BcoDI GTCTC 2 cut(s) 254, 320
BfaI CTAG 1 cut(s) 219
BfmI CTRYAG 1 cut(s) 87
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 2 cut(s) 59, 143
BmgT120I GGNCC 3 cut(s) 59, 123, 143
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 243
BmsI GCATC 1 cut(s) 101
BoxI GACNNNNGTC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 254
BsaJI CCNNGG 2 cut(s) 146, 241
Bsc4I CCNNNNNNNGG 1 cut(s) 16
Bse1I ACTGG 2 cut(s) 195, 227
BseBI CCWGG 1 cut(s) 243
BseDI CCNNGG 2 cut(s) 146, 241
BseLI CCNNNNNNNGG 1 cut(s) 16
BseNI ACTGG 2 cut(s) 195, 227
BseXI GCAGC 1 cut(s) 67
BseYI CCCAGC 1 cut(s) 76
BshFI GGCC 1 cut(s) 124
BshNI GGYRCC 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 16
BsmAI GTCTC 2 cut(s) 254, 320
BsnI GGCC 1 cut(s) 124
Bso31I GGTCTC 1 cut(s) 254
BspACI CCGC 1 cut(s) 179
BspANI GGCC 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 49
BspT107I GGYRCC 1 cut(s) 47
BspTNI GGTCTC 1 cut(s) 254
BsrI ACTGG 2 cut(s) 195, 227
BssECI CCNNGG 2 cut(s) 146, 241
BssT1I CCWWGG 1 cut(s) 146
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 88
BstMAI GTCTC 2 cut(s) 254, 320
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 243
BstNSI RCATGY 1 cut(s) 266
BstPAI GACNNNNGTC 1 cut(s) 57
BstSCI CCNGG 1 cut(s) 241
BstSFI CTRYAG 1 cut(s) 87
BstV1I GCAGC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 124
Cfr13I GGNCC 3 cut(s) 59, 123, 143
CviAII CATG 2 cut(s) 263, 342
CviJI RGCY 4 cut(s) 75, 80, 124, 169
CviKI_1 RGCY 4 cut(s) 75, 80, 124, 169
Eco130I CCWWGG 1 cut(s) 146
Eco31I GGTCTC 1 cut(s) 254
Eco47I GGWCC 2 cut(s) 59, 143
EcoO109I RGGNCCY 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 146
EcoT22I ATGCAT 1 cut(s) 264
ErhI CCWWGG 1 cut(s) 146
FaeI CATG 2 cut(s) 266, 345
FaiI YATR 5 cut(s) 56, 72, 260, 264, 343
FatI CATG 2 cut(s) 262, 341
FauI CCCGC 1 cut(s) 172
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 219
GluI GCNGC 1 cut(s) 81
GsaI CCCAGC 1 cut(s) 80
HaeIII GGCC 1 cut(s) 124
Hin1II CATG 2 cut(s) 266, 345
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 2 cut(s) 215, 317
HphI GGTGA 2 cut(s) 245, 312
Hpy166II GTNNAC 1 cut(s) 236
Hpy188I TCNGA 2 cut(s) 35, 43
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 1 cut(s) 236
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4V TGCA 4 cut(s) 262, 287, 310, 345
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 2 cut(s) 266, 345
LpnPI CCDG 8 cut(s) 90, 176, 187, 228, 240, 255, 294, 336
Lsp1109I GCAGC 1 cut(s) 67
LweI GCATC 1 cut(s) 101
MaeI CTAG 1 cut(s) 219
MluCI AATT 2 cut(s) 29, 305
MnlI CCTC 4 cut(s) 16, 72, 239, 342
Mph1103I ATGCAT 1 cut(s) 264
MseI TTAA 1 cut(s) 174
MslI CAYNNNNRTG 2 cut(s) 257, 334
MspA1I CMGCKG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 89
NlaIII CATG 2 cut(s) 266, 345
NlaIV GGNNCC 1 cut(s) 49
NsiI ATGCAT 1 cut(s) 264
NspI RCATGY 1 cut(s) 266
PfeI GAWTC 2 cut(s) 215, 317
PflMI CCANNNNNTGG 1 cut(s) 16
PkrI GCNGC 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 59
PshAI GACNNNNGTC 1 cut(s) 57
PshBI ATTAAT 1 cut(s) 174
Psp5II RGGWCCY 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 241
PspFI CCCAGC 1 cut(s) 76
PspGI CCWGG 1 cut(s) 241
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 3 cut(s) 59, 123, 143
PspPPI RGGWCCY 1 cut(s) 59
PvuII CAGCTG 1 cut(s) 80
RseI CAYNNNNRTG 2 cut(s) 257, 334
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 81
Sau96I GGNCC 3 cut(s) 59, 123, 143
ScrFI CCNGG 1 cut(s) 243
SetI ASST 6 cut(s) 27, 61, 82, 171, 250, 334
SfaNI GCATC 1 cut(s) 101
SfcI CTRYAG 1 cut(s) 87
SinI GGWCC 2 cut(s) 59, 143
SmiMI CAYNNNNRTG 2 cut(s) 257, 334
Sse9I AATT 2 cut(s) 29, 305
SsiI CCGC 1 cut(s) 179
SspI AATATT 1 cut(s) 351
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 146
TaaI ACNGT 1 cut(s) 88
TaqI TCGA 1 cut(s) 334
TasI AATT 2 cut(s) 29, 305
TfiI GAWTC 2 cut(s) 215, 317
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 330
Van91I CCANNNNNTGG 1 cut(s) 16
VpaK11BI GGWCC 2 cut(s) 59, 143
VspI ATTAAT 1 cut(s) 174
XapI RAATTY 1 cut(s) 29
XbaI TCTAGA 1 cut(s) 218
XceI RCATGY 1 cut(s) 266
XspI CTAG 1 cut(s) 219
Zsp2I ATGCAT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.