RLG00000007326

ER membrane protein complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0012102
Physical Location & Seq
Forward (+)
15850503 .. 15851634
1132 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000007326

Sequence Viewer

Length: 435 bp
ATGACAGCCCATTTGACCTTGGCCCCTTTAGTTCTTTCCCATCCGATATTGTTTACAAGCTTACAAAAAGCAGAAGCTATGGTTGGACATAATGAGTCATCTGGGAAGAAATCTAGCGAGGCCACAAATGATGTTCCGACCCTGAATGCGGAGAGTTTGCAAAGTAACATGAAAATTATCTACTATAGCCGAACATTTATGTCTATCATTGGTGGGGTCATTGCTGGAATTTTGGGGTTCACCGGCCTTTCTGGATTTGTGTTGTATTTTCTTATTATGGCCATCACTTCGGTTGGACTCATTGCAAAGGCAGGGTTTCAGGTTCATTCGTATTTTGACAGCTGGAACCAGATTATACTCGATGGTTTCCTGGGTGGGCTTCTGTCGTTTGTGCTTTTCTGGACGTTTGCTTATGACATTGTGCATATATTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rab5ip

Protein Analysis

145

Amino Acids

15.72

Weight (kDa)

6.15

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMC6 PF07019 60 - 138 2.3e-21 EMC6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012102)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G49540 AT5G49540
fragaria_vesca FvH4_4g20620
malus_domestica MD13G1149300.v1.1 MD16G1149600.v1.1
prunus_persica Prupe.1G113300_v2.0.a1
pyrus_communis pycom13g12850 pycom16g12810
rosa_chinensis RchiOBHm_Chr4g0425981
rosa_laevigata RLG00000007326
rosa_multiflora Rmu_ssc0000281.1_g000021
rosa_roxburghii Rroxscaffold_5G00367990
rosa_rugosa Rorug04G0207800
rosa_samantha Rh4AG264800 Rh4BG270700 Rh4CG283300 Rh4CG283600 Rh4DG267300
rosa_wichuraiana Rw4G022870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 279
AcsI RAATTY 1 cut(s) 228
AfiI CCNNNNNNNGG 1 cut(s) 148
AjnI CCWGG 1 cut(s) 369
AjuI GAANNNNNNNTTGG 2 cut(s) 66, 98
AluBI AGCT 3 cut(s) 60, 77, 342
AluI AGCT 3 cut(s) 60, 77, 342
AoxI GGCC 4 cut(s) 21, 120, 244, 279
ApoI RAATTY 1 cut(s) 228
ArsI GACNNNNNNTTYG 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 232
BalI TGGCCA 1 cut(s) 281
BccI CCATC 3 cut(s) 48, 290, 356
BciT130I CCWGG 1 cut(s) 371
BfaI CTAG 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 371
BmgT120I GGNCC 1 cut(s) 22
BmiI GGNNCC 2 cut(s) 24, 347
BmrFI CCNGG 1 cut(s) 371
BsaJI CCNNGG 2 cut(s) 18, 370
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse118I RCCGGY 1 cut(s) 242
Bse3DI GCAATG 2 cut(s) 219, 300
BseBI CCWGG 1 cut(s) 371
BseDI CCNNGG 2 cut(s) 18, 370
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMI GCAATG 2 cut(s) 219, 300
BshFI GGCC 4 cut(s) 23, 122, 246, 281
BsiSI CCGG 1 cut(s) 243
BslI CCNNNNNNNGG 1 cut(s) 148
BsmI GAATGC 1 cut(s) 151
BsnI GGCC 4 cut(s) 23, 122, 246, 281
BspACI CCGC 1 cut(s) 149
BspANI GGCC 4 cut(s) 23, 122, 246, 281
BspLI GGNNCC 2 cut(s) 24, 347
BsrDI GCAATG 2 cut(s) 219, 300
BsrFI RCCGGY 1 cut(s) 242
BssAI RCCGGY 1 cut(s) 242
BssECI CCNNGG 2 cut(s) 18, 370
BssT1I CCWWGG 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 371
BstF5I GGATG 1 cut(s) 40
BstNI CCWGG 1 cut(s) 371
BstSCI CCNGG 1 cut(s) 369
BstSFI CTRYAG 1 cut(s) 184
BsuRI GGCC 4 cut(s) 23, 122, 246, 281
BtsCI GGATG 1 cut(s) 40
Cfr10I RCCGGY 1 cut(s) 242
Cfr13I GGNCC 1 cut(s) 22
CviAII CATG 1 cut(s) 169
EaeI YGGCCR 1 cut(s) 279
Eco130I CCWWGG 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 369
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaeI CATG 1 cut(s) 172
FatI CATG 1 cut(s) 168
FokI GGATG 1 cut(s) 27
FspBI CTAG 1 cut(s) 114
HaeIII GGCC 4 cut(s) 23, 122, 246, 281
HapII CCGG 1 cut(s) 243
Hin1II CATG 1 cut(s) 172
HindIII AAGCTT 1 cut(s) 58
HinfI GANTC 2 cut(s) 95, 297
HpaII CCGG 1 cut(s) 243
HphI GGTGA 1 cut(s) 232
Hpy166II GTNNAC 2 cut(s) 54, 240
Hpy188I TCNGA 3 cut(s) 45, 138, 434
Hpy188III TCNNGA 2 cut(s) 252, 400
Hpy8I GTNNAC 2 cut(s) 54, 240
HpyCH4IV ACGT 1 cut(s) 404
HpyCH4V TGCA 3 cut(s) 160, 305, 424
HpySE526I ACGT 1 cut(s) 404
Hsp92II CATG 1 cut(s) 172
MaeI CTAG 1 cut(s) 114
MaeII ACGT 1 cut(s) 404
MaeIII GTNAC 1 cut(s) 164
MboII GAAGA 1 cut(s) 118
MlsI TGGCCA 1 cut(s) 281
MluCI AATT 2 cut(s) 174, 228
MluNI TGGCCA 1 cut(s) 281
MlyI GAGTC 2 cut(s) 104, 291
MmeI TCCRAC 3 cut(s) 64, 161, 274
MnlI CCTC 1 cut(s) 112
Mox20I TGGCCA 1 cut(s) 281
MscI TGGCCA 1 cut(s) 281
Msp20I TGGCCA 1 cut(s) 281
MspA1I CMGCKG 1 cut(s) 342
MspI CCGG 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 371
Mva1269I GAATGC 1 cut(s) 151
MvaI CCWGG 1 cut(s) 371
NlaIII CATG 1 cut(s) 172
NlaIV GGNNCC 2 cut(s) 24, 347
PctI GAATGC 1 cut(s) 151
PleI GAGTC 2 cut(s) 103, 291
PpsI GAGTC 2 cut(s) 103, 291
Psp6I CCWGG 1 cut(s) 369
PspGI CCWGG 1 cut(s) 369
PspN4I GGNNCC 2 cut(s) 24, 347
PspPI GGNCC 1 cut(s) 22
PvuII CAGCTG 1 cut(s) 342
Sau96I GGNCC 1 cut(s) 22
SchI GAGTC 2 cut(s) 104, 291
ScrFI CCNGG 1 cut(s) 371
SetI ASST 6 cut(s) 20, 62, 79, 324, 344, 407
SfcI CTRYAG 1 cut(s) 184
Sse9I AATT 2 cut(s) 174, 228
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 369
StyI CCWWGG 1 cut(s) 18
TaiI ACGT 1 cut(s) 407
TaqI TCGA 1 cut(s) 360
TasI AATT 2 cut(s) 174, 228
TspDTI ATGAA 2 cut(s) 185, 314
XapI RAATTY 1 cut(s) 228
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.