Rmu_ssc0000281.1_g000021

ER membrane protein complex subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000281.1
Physical Location & Seq
Forward (+)
79036 .. 80717
1682 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000281.1_g000021.1.cds

Sequence Viewer

Length: 402 bp
ctgagtgtaaagatattgtttacaagcttacaaaaagcagaagctatggctggacataatgagtcatctgggaagaaatctagcgaggccacaaatgatgttccgaccctgaatgcggagagtttgcaaagtaacatgaaaattatctactacagccgaacatttatgtctatcattggcggggtcattgctggaattttggggttcaccggcctttctggatttgttttgtattttcttattatggccatcacttcggttggactcattgcaaaggcagggtttcaggttcattcgtattttgacagctggaaccagattatactcgatggtttcctgggtgggcttctgtcgtttgtgcttttctggacgtttgcttatgacattgtgcatatattctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

14.53

Weight (kDa)

6.29

Isoelectric Point (pI)

44.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012102)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 116, 180
AcoI YGGCCR 1 cut(s) 246
AcsI RAATTY 1 cut(s) 195
AfiI CCNNNNNNNGG 1 cut(s) 115
AjnI CCWGG 1 cut(s) 336
AluBI AGCT 3 cut(s) 27, 44, 309
AluI AGCT 3 cut(s) 27, 44, 309
AoxI GGCC 3 cut(s) 87, 211, 246
ApoI RAATTY 1 cut(s) 195
AsuHPI GGTGA 1 cut(s) 199
BalI TGGCCA 1 cut(s) 248
BccI CCATC 2 cut(s) 257, 323
BciT130I CCWGG 1 cut(s) 338
BfaI CTAG 1 cut(s) 81
BfmI CTRYAG 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 338
BmiI GGNNCC 1 cut(s) 314
BmrFI CCNGG 1 cut(s) 338
BsaJI CCNNGG 1 cut(s) 337
Bsc4I CCNNNNNNNGG 1 cut(s) 115
Bse118I RCCGGY 1 cut(s) 209
Bse3DI GCAATG 2 cut(s) 186, 267
BseBI CCWGG 1 cut(s) 338
BseDI CCNNGG 1 cut(s) 337
BseLI CCNNNNNNNGG 1 cut(s) 115
BseMI GCAATG 2 cut(s) 186, 267
BshFI GGCC 3 cut(s) 89, 213, 248
BsiSI CCGG 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 115
BsmI GAATGC 1 cut(s) 118
BsnI GGCC 3 cut(s) 89, 213, 248
BspACI CCGC 2 cut(s) 116, 180
BspANI GGCC 3 cut(s) 89, 213, 248
BspLI GGNNCC 1 cut(s) 314
BsrDI GCAATG 2 cut(s) 186, 267
BsrFI RCCGGY 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 337
Bst2UI CCWGG 1 cut(s) 338
BstDEI CTNAG 1 cut(s) 2
BstNI CCWGG 1 cut(s) 338
BstSCI CCNGG 1 cut(s) 336
BstSFI CTRYAG 1 cut(s) 151
BsuRI GGCC 3 cut(s) 89, 213, 248
Cfr10I RCCGGY 1 cut(s) 209
CviAII CATG 1 cut(s) 136
CviJI RGCY 9 cut(s) 27, 44, 50, 89, 156, 213, 248, 309, 346
CviKI_1 RGCY 9 cut(s) 27, 44, 50, 89, 156, 213, 248, 309, 346
DdeI CTNAG 1 cut(s) 2
EaeI YGGCCR 1 cut(s) 246
EcoRII CCWGG 1 cut(s) 336
FaeI CATG 1 cut(s) 139
FaiI YATR 9 cut(s) 47, 57, 137, 167, 245, 323, 381, 393, 395
FatI CATG 1 cut(s) 135
FauI CCCGC 1 cut(s) 173
FspBI CTAG 1 cut(s) 81
HaeIII GGCC 3 cut(s) 89, 213, 248
HapII CCGG 1 cut(s) 210
Hin1II CATG 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 25
HinfI GANTC 2 cut(s) 62, 264
HpaII CCGG 1 cut(s) 210
HphI GGTGA 1 cut(s) 199
Hpy166II GTNNAC 2 cut(s) 21, 207
Hpy188I TCNGA 2 cut(s) 105, 401
Hpy188III TCNNGA 2 cut(s) 219, 367
Hpy8I GTNNAC 2 cut(s) 21, 207
HpyCH4IV ACGT 1 cut(s) 371
HpyCH4V TGCA 3 cut(s) 127, 272, 391
HpyF3I CTNAG 1 cut(s) 2
HpySE526I ACGT 1 cut(s) 371
Hsp92II CATG 1 cut(s) 139
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 371
MaeIII GTNAC 1 cut(s) 131
MboII GAAGA 1 cut(s) 85
MlsI TGGCCA 1 cut(s) 248
MluCI AATT 2 cut(s) 141, 195
MluNI TGGCCA 1 cut(s) 248
MlyI GAGTC 2 cut(s) 71, 258
MmeI TCCRAC 2 cut(s) 128, 241
MnlI CCTC 1 cut(s) 79
Mox20I TGGCCA 1 cut(s) 248
MscI TGGCCA 1 cut(s) 248
Msp20I TGGCCA 1 cut(s) 248
MspA1I CMGCKG 1 cut(s) 309
MspI CCGG 1 cut(s) 210
MspR9I CCNGG 1 cut(s) 338
Mva1269I GAATGC 1 cut(s) 118
MvaI CCWGG 1 cut(s) 338
NlaIII CATG 1 cut(s) 139
NlaIV GGNNCC 1 cut(s) 314
PctI GAATGC 1 cut(s) 118
PleI GAGTC 2 cut(s) 70, 258
PpsI GAGTC 2 cut(s) 70, 258
Psp6I CCWGG 1 cut(s) 336
PspGI CCWGG 1 cut(s) 336
PspN4I GGNNCC 1 cut(s) 314
PvuII CAGCTG 1 cut(s) 309
SchI GAGTC 2 cut(s) 71, 258
ScrFI CCNGG 1 cut(s) 338
SetI ASST 5 cut(s) 29, 46, 291, 311, 374
SfcI CTRYAG 1 cut(s) 151
Sse9I AATT 2 cut(s) 141, 195
SsiI CCGC 2 cut(s) 116, 180
SspMI CTAG 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 336
TaiI ACGT 1 cut(s) 374
TaqI TCGA 1 cut(s) 327
TasI AATT 2 cut(s) 141, 195
TspDTI ATGAA 2 cut(s) 152, 281
XapI RAATTY 1 cut(s) 195
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.