RLG00000012915

Acyl-coenzyme A thioesterase 9

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0018167
Physical Location & Seq
Forward (+)
23831898 .. 23833842
1945 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000012915

Sequence Viewer

Length: 420 bp
ATGGACCCAAATTCATCTCCTTGCAATTCCAATTCCAACACCACCATTACGGTAGTGGCAACCATCCCCGCTTTCGGGTCGGACTCTTCGACCCGGAAGCCCATCAGCTTGTGGCCCGGAATGTTCCACTCGCCGGTGACCCAGGCACTGTGGGAAGCGAGGTCTCACATGTTCGAGAGGCTCTTGGACCCACCAGCAGACGCTCCTCCACAGAGCCAATTGCTGAACAAGACTCCATCACAGAGCAGGACTACAGTTCTGTACAATTTCTCTACTGATTTTACACTGAGGGATCCTTGGAATGAGGTCCGACTTGGGAAACTGCTTGAAGACCTTGATGCTTTAGCTGGAACCATTTCTGTCAAGTCATTGGTGGTTTCGAAATTTGCTGTGCCGTCATTTCTTGGGGAGGAAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
4HBT

Protein Analysis

140

Amino Acids

15.22

Weight (kDa)

5.25

Isoelectric Point (pI)

52.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018167)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0496731 RchiOBHm_Chr6g0282071
rosa_laevigata RLG00000012911 RLG00000012915 RLG00000036813
rosa_multiflora Rmu_sc0001700.1_g000034 Rmu_sc0005149.1_g000003 Rmu_sc0011075.1_g000010
rosa_rugosa Rorug06G0145200
rosa_samantha Rh6CG260400
rosa_wichuraiana Rw6G022340

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 2 cut(s) 287, 300
AcsI RAATTY 2 cut(s) 10, 383
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 3 cut(s) 74, 75, 133
AflIII ACRYGT 1 cut(s) 168
AgsI TTSAA 1 cut(s) 329
AjnI CCWGG 1 cut(s) 141
AluBI AGCT 3 cut(s) 108, 347, 417
AluI AGCT 3 cut(s) 108, 347, 417
Alw26I GTCTC 1 cut(s) 168
AlwI GGATC 2 cut(s) 287, 300
AlwNI CAGNNNCTG 1 cut(s) 148
AoxI GGCC 1 cut(s) 113
ApoI RAATTY 2 cut(s) 10, 383
Asp700I GAANNNNTTC 1 cut(s) 355
AspS9I GGNCC 4 cut(s) 4, 114, 187, 307
AsuC2I CCSGG 2 cut(s) 94, 117
AsuHPI GGTGA 1 cut(s) 148
AsuII TTCGAA 1 cut(s) 380
AvaII GGWCC 3 cut(s) 4, 187, 307
BamHI GGATCC 1 cut(s) 292
BbsI GAAGAC 1 cut(s) 336
BccI CCATC 3 cut(s) 71, 110, 244
BceAI ACGGC 1 cut(s) 379
BciT130I CCWGG 1 cut(s) 143
BcnI CCSGG 2 cut(s) 94, 117
BcoDI GTCTC 1 cut(s) 168
BfmI CTRYAG 1 cut(s) 252
Bme1390I CCNGG 3 cut(s) 94, 117, 143
Bme18I GGWCC 3 cut(s) 4, 187, 307
BmgT120I GGNCC 4 cut(s) 4, 114, 187, 307
BmiI GGNNCC 4 cut(s) 6, 189, 294, 352
BmrFI CCNGG 3 cut(s) 94, 117, 143
BmsI GCATC 1 cut(s) 328
BpiI GAAGAC 1 cut(s) 336
Bpu14I TTCGAA 1 cut(s) 380
BpuMI CCSGG 2 cut(s) 94, 117
BsaI GGTCTC 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 141, 296
Bsc4I CCNNNNNNNGG 3 cut(s) 74, 75, 133
Bse118I RCCGGY 1 cut(s) 133
BseBI CCWGG 1 cut(s) 143
BseDI CCNNGG 2 cut(s) 141, 296
BseGI GGATG 1 cut(s) 63
BseLI CCNNNNNNNGG 3 cut(s) 74, 75, 133
BseMII CTCAG 1 cut(s) 278
BseRI GAGGAG 1 cut(s) 195
BshFI GGCC 1 cut(s) 115
BsiSI CCGG 3 cut(s) 94, 117, 134
BslI CCNNNNNNNGG 3 cut(s) 74, 75, 133
BsmAI GTCTC 1 cut(s) 168
BsnI GGCC 1 cut(s) 115
Bso31I GGTCTC 1 cut(s) 168
Bsp119I TTCGAA 1 cut(s) 380
Bsp1407I TGTACA 1 cut(s) 261
Bsp143I GATC 1 cut(s) 292
BspACI CCGC 1 cut(s) 69
BspANI GGCC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 279
BspLI GGNNCC 4 cut(s) 6, 189, 294, 352
BspPI GGATC 2 cut(s) 287, 300
BspT104I TTCGAA 1 cut(s) 380
BspTNI GGTCTC 1 cut(s) 168
BsrFI RCCGGY 1 cut(s) 133
BsrGI TGTACA 1 cut(s) 261
BssAI RCCGGY 1 cut(s) 133
BssECI CCNNGG 2 cut(s) 141, 296
BssMI GATC 1 cut(s) 292
BssT1I CCWWGG 1 cut(s) 296
Bst2UI CCWGG 1 cut(s) 143
Bst4CI ACNGT 3 cut(s) 52, 150, 256
Bst6I CTCTTC 1 cut(s) 91
BstAUI TGTACA 1 cut(s) 261
BstBI TTCGAA 1 cut(s) 380
BstDEI CTNAG 1 cut(s) 287
BstEII GGTNACC 1 cut(s) 136
BstF5I GGATG 1 cut(s) 63
BstKTI GATC 1 cut(s) 295
BstMAI GTCTC 1 cut(s) 168
BstMBI GATC 1 cut(s) 292
BstNI CCWGG 1 cut(s) 143
BstNSI RCATGY 1 cut(s) 172
BstPI GGTNACC 1 cut(s) 136
BstSCI CCNGG 3 cut(s) 92, 115, 141
BstSFI CTRYAG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 336
BstX2I RGATCY 1 cut(s) 292
BstYI RGATCY 1 cut(s) 292
BsuRI GGCC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 63
BtsIMutI CAGTG 2 cut(s) 146, 284
CaiI CAGNNNCTG 1 cut(s) 148
Cfr10I RCCGGY 1 cut(s) 133
Cfr13I GGNCC 4 cut(s) 4, 114, 187, 307
CseI GACGC 1 cut(s) 209
Csp6I GTAC 1 cut(s) 262
CviAII CATG 1 cut(s) 169
CviJI RGCY 7 cut(s) 100, 108, 115, 181, 216, 347, 417
CviKI_1 RGCY 7 cut(s) 100, 108, 115, 181, 216, 347, 417
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 1 cut(s) 287
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
Eam1104I CTCTTC 1 cut(s) 91
EarI CTCTTC 1 cut(s) 91
Eco130I CCWWGG 1 cut(s) 296
Eco31I GGTCTC 1 cut(s) 168
Eco47I GGWCC 3 cut(s) 4, 187, 307
Eco91I GGTNACC 1 cut(s) 136
EcoO65I GGTNACC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 296
ErhI CCWWGG 1 cut(s) 296
FaeI CATG 1 cut(s) 172
FaiI YATR 1 cut(s) 170
FatI CATG 1 cut(s) 168
FauI CCCGC 1 cut(s) 76
FokI GGATG 1 cut(s) 50
HaeIII GGCC 1 cut(s) 115
HapII CCGG 3 cut(s) 94, 117, 134
HgaI GACGC 1 cut(s) 209
Hin1II CATG 1 cut(s) 172
HinfI GANTC 2 cut(s) 83, 232
HpaII CCGG 3 cut(s) 94, 117, 134
HphI GGTGA 1 cut(s) 148
Hpy188I TCNGA 2 cut(s) 82, 311
Hpy188III TCNNGA 1 cut(s) 175
HpyCH4III ACNGT 3 cut(s) 52, 150, 256
HpyCH4V TGCA 1 cut(s) 24
HpyF3I CTNAG 1 cut(s) 287
Hsp92II CATG 1 cut(s) 172
Kzo9I GATC 1 cut(s) 292
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 8 cut(s) 107, 128, 130, 147, 155, 207, 232, 333
LweI GCATC 1 cut(s) 328
MaeIII GTNAC 1 cut(s) 136
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MboII GAAGA 2 cut(s) 78, 341
MfeI CAATTG 1 cut(s) 218
MflI RGATCY 1 cut(s) 292
MluCI AATT 6 cut(s) 10, 25, 31, 218, 265, 383
MlyI GAGTC 2 cut(s) 77, 226
MmeI TCCRAC 3 cut(s) 60, 60, 334
MnlI CCTC 6 cut(s) 153, 171, 216, 282, 298, 403
MroXI GAANNNNTTC 1 cut(s) 355
MspI CCGG 3 cut(s) 94, 117, 134
MspR9I CCNGG 3 cut(s) 94, 117, 143
MunI CAATTG 1 cut(s) 218
MvaI CCWGG 1 cut(s) 143
NciI CCSGG 2 cut(s) 94, 117
NdeII GATC 1 cut(s) 292
NlaIII CATG 1 cut(s) 172
NlaIV GGNNCC 4 cut(s) 6, 189, 294, 352
NmuCI GTSAC 1 cut(s) 136
NspI RCATGY 1 cut(s) 172
NspV TTCGAA 1 cut(s) 380
PciI ACATGT 1 cut(s) 168
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PdmI GAANNNNTTC 1 cut(s) 355
PleI GAGTC 2 cut(s) 77, 226
PpsI GAGTC 2 cut(s) 77, 226
PscI ACATGT 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 141
PspEI GGTNACC 1 cut(s) 136
PspGI CCWGG 1 cut(s) 141
PspN4I GGNNCC 4 cut(s) 6, 189, 294, 352
PspPI GGNCC 4 cut(s) 4, 114, 187, 307
PstNI CAGNNNCTG 1 cut(s) 148
PsuI RGATCY 1 cut(s) 292
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
Sau3AI GATC 1 cut(s) 292
Sau96I GGNCC 4 cut(s) 4, 114, 187, 307
SchI GAGTC 2 cut(s) 77, 226
ScrFI CCNGG 3 cut(s) 94, 117, 143
SetI ASST 6 cut(s) 110, 164, 309, 336, 349, 419
SfaNI GCATC 1 cut(s) 328
SfcI CTRYAG 1 cut(s) 252
SfuI TTCGAA 1 cut(s) 380
SgrAI CRCCGGYG 1 cut(s) 133
SinI GGWCC 3 cut(s) 4, 187, 307
Sse9I AATT 6 cut(s) 10, 25, 31, 218, 265, 383
SsiI CCGC 1 cut(s) 69
StyD4I CCNGG 3 cut(s) 92, 115, 141
StyI CCWWGG 1 cut(s) 296
TaaI ACNGT 3 cut(s) 52, 150, 256
TaqI TCGA 3 cut(s) 89, 174, 380
TasI AATT 6 cut(s) 10, 25, 31, 218, 265, 383
TatI WGTACW 1 cut(s) 261
TscAI CASTG 2 cut(s) 153, 291
TseFI GTSAC 1 cut(s) 136
Tsp45I GTSAC 1 cut(s) 136
TspRI CASTG 2 cut(s) 153, 291
VpaK11BI GGWCC 3 cut(s) 4, 187, 307
XapI RAATTY 2 cut(s) 10, 383
XceI RCATGY 1 cut(s) 172
XcmI CCANNNNNNNNNTGG 1 cut(s) 52
XmnI GAANNNNTTC 1 cut(s) 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.