Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001700.1

Orthogroup ID

OG0018167

Physical Location & Seq

Genomic Coordinates Reverse (-)

169888 .. 170268

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001700.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atgttccactcgccggtgacacaggcactgtgggaagcgaggtctcacatgttcgagaggctcttggacccaccagcagacgctcctccacagagccaattgctaaacaagactccatcgcagagcaggactacaattctgtacaatttctctactgattttatactgagggagcagtacagggatccttggaatgaggtccgaattgggaaactgcttgaaaaccttgatgctttagctggaaccatttctgtcaaggtatcaatttctagtctttctgtgtttggactttggatttgtgggttttgcttcaaatttggttacttgaactgggttgtgattggttatggagtcatacatatgtggatcgtatcaaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

4HBT

Protein Analysis

126

Amino Acids

14.45

Weight (kDa)

7.81

Isoelectric Point (pI)

40.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018167)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0496731 RchiOBHm_Chr6g0282071
rosa_laevigata	RLG00000012911 RLG00000012915 RLG00000036813
rosa_multiflora	Rmu_sc0001700.1_g000034 Rmu_sc0005149.1_g000003 Rmu_sc0011075.1_g000010
rosa_rugosa	Rorug06G0145200
rosa_samantha	Rh6CG260400
rosa_wichuraiana	Rw6G022340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	179, 192, 374
AcsI	RAATTY	1 cut(s)	314
AfaI	GTAC	2 cut(s)	143, 179
AfiI	CCNNNNNNNGG	1 cut(s)	13
AflIII	ACRYGT	1 cut(s)	48
AgsI	TTSAA	3 cut(s)	221, 313, 328
AluBI	AGCT	1 cut(s)	239
AluI	AGCT	1 cut(s)	239
Alw26I	GTCTC	1 cut(s)	48
AlwI	GGATC	3 cut(s)	179, 192, 374
AlwNI	CAGNNNCTG	1 cut(s)	28
ApoI	RAATTY	1 cut(s)	314
ArsI	GACNNNNNNTTYG	2 cut(s)	279, 311
Asp700I	GAANNNNTTC	1 cut(s)	247
AspS9I	GGNCC	2 cut(s)	67, 199
AsuHPI	GGTGA	1 cut(s)	28
AvaII	GGWCC	2 cut(s)	67, 199
BamHI	GGATCC	1 cut(s)	184
BccI	CCATC	1 cut(s)	124
BcoDI	GTCTC	1 cut(s)	48
BfaI	CTAG	1 cut(s)	270
Bme18I	GGWCC	2 cut(s)	67, 199
BmgT120I	GGNCC	2 cut(s)	67, 199
BmiI	GGNNCC	3 cut(s)	69, 186, 244
BmrI	ACTGGG	1 cut(s)	340
BmsI	GCATC	1 cut(s)	220
BmuI	ACTGGG	1 cut(s)	340
BsaI	GGTCTC	1 cut(s)	48
BsaJI	CCNNGG	1 cut(s)	188
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
Bse118I	RCCGGY	1 cut(s)	13
Bse1I	ACTGG	1 cut(s)	335
BseDI	CCNNGG	1 cut(s)	188
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseMII	CTCAG	1 cut(s)	158
BseNI	ACTGG	1 cut(s)	335
BseRI	GAGGAG	1 cut(s)	75
BsiSI	CCGG	1 cut(s)	14
BslI	CCNNNNNNNGG	1 cut(s)	13
BsmAI	GTCTC	1 cut(s)	48
Bso31I	GGTCTC	1 cut(s)	48
Bsp1407I	TGTACA	1 cut(s)	141
Bsp143I	GATC	2 cut(s)	184, 366
BspCNI	CTCAG	1 cut(s)	159
BspLI	GGNNCC	3 cut(s)	69, 186, 244
BspPI	GGATC	3 cut(s)	179, 192, 374
BspTNI	GGTCTC	1 cut(s)	48
BsrFI	RCCGGY	1 cut(s)	13
BsrGI	TGTACA	1 cut(s)	141
BsrI	ACTGG	1 cut(s)	335
BssAI	RCCGGY	1 cut(s)	13
BssECI	CCNNGG	1 cut(s)	188
BssMI	GATC	2 cut(s)	184, 366
BssT1I	CCWWGG	1 cut(s)	188
Bst4CI	ACNGT	1 cut(s)	30
BstAUI	TGTACA	1 cut(s)	141
BstDEI	CTNAG	1 cut(s)	167
BstKTI	GATC	2 cut(s)	187, 369
BstMAI	GTCTC	1 cut(s)	48
BstMBI	GATC	2 cut(s)	184, 366
BstNSI	RCATGY	1 cut(s)	52
BstX2I	RGATCY	1 cut(s)	184
BstYI	RGATCY	1 cut(s)	184
BtgZI	GCGATG	1 cut(s)	102
BtsIMutI	CAGTG	1 cut(s)	26
CaiI	CAGNNNCTG	1 cut(s)	28
Cfr10I	RCCGGY	1 cut(s)	13
Cfr13I	GGNCC	2 cut(s)	67, 199
CseI	GACGC	1 cut(s)	89
Csp6I	GTAC	2 cut(s)	142, 178
CviAII	CATG	1 cut(s)	49
CviJI	RGCY	3 cut(s)	61, 96, 239
CviKI_1	RGCY	3 cut(s)	61, 96, 239
CviQI	GTAC	2 cut(s)	142, 178
DdeI	CTNAG	1 cut(s)	167
DpnI	GATC	2 cut(s)	186, 368
DpnII	GATC	2 cut(s)	184, 366
Eco130I	CCWWGG	1 cut(s)	188
Eco31I	GGTCTC	1 cut(s)	48
Eco47I	GGWCC	2 cut(s)	67, 199
EcoT14I	CCWWGG	1 cut(s)	188
ErhI	CCWWGG	1 cut(s)	188
FaeI	CATG	1 cut(s)	52
FaiI	YATR	6 cut(s)	50, 164, 348, 356, 360, 362
FatI	CATG	1 cut(s)	48
FauNDI	CATATG	1 cut(s)	360
FspBI	CTAG	1 cut(s)	270
HapII	CCGG	1 cut(s)	14
HgaI	GACGC	1 cut(s)	89
Hin1II	CATG	1 cut(s)	52
HinfI	GANTC	2 cut(s)	112, 351
HpaII	CCGG	1 cut(s)	14
HphI	GGTGA	1 cut(s)	28
Hpy188I	TCNGA	1 cut(s)	203
Hpy188III	TCNNGA	1 cut(s)	55
HpyCH4III	ACNGT	1 cut(s)	30
HpyF3I	CTNAG	1 cut(s)	167
Hsp92II	CATG	1 cut(s)	52
Kzo9I	GATC	2 cut(s)	184, 366
LmnI	GCTCC	2 cut(s)	88, 172
LpnPI	CCDG	7 cut(s)	8, 27, 87, 112, 166, 225, 316
LweI	GCATC	1 cut(s)	220
MaeI	CTAG	1 cut(s)	270
MaeIII	GTNAC	2 cut(s)	16, 320
MalI	GATC	2 cut(s)	186, 368
MboI	GATC	2 cut(s)	184, 366
MfeI	CAATTG	1 cut(s)	98
MflI	RGATCY	1 cut(s)	184
MluCI	AATT	6 cut(s)	98, 135, 145, 204, 264, 314
MlyI	GAGTC	2 cut(s)	106, 360
MnlI	CCTC	5 cut(s)	33, 51, 96, 162, 190
MroXI	GAANNNNTTC	1 cut(s)	247
MslI	CAYNNNNRTG	1 cut(s)	359
MspI	CCGG	1 cut(s)	14
MunI	CAATTG	1 cut(s)	98
NdeI	CATATG	1 cut(s)	360
NdeII	GATC	2 cut(s)	184, 366
NlaIII	CATG	1 cut(s)	52
NlaIV	GGNNCC	3 cut(s)	69, 186, 244
NmuCI	GTSAC	1 cut(s)	16
NspI	RCATGY	1 cut(s)	52
PciI	ACATGT	1 cut(s)	48
PdmI	GAANNNNTTC	1 cut(s)	247
PleI	GAGTC	2 cut(s)	106, 359
PpsI	GAGTC	2 cut(s)	106, 359
PscI	ACATGT	1 cut(s)	48
PspN4I	GGNNCC	3 cut(s)	69, 186, 244
PspPI	GGNCC	2 cut(s)	67, 199
PstNI	CAGNNNCTG	1 cut(s)	28
PsuI	RGATCY	1 cut(s)	184
RsaI	GTAC	2 cut(s)	143, 179
RsaNI	GTAC	2 cut(s)	142, 178
RseI	CAYNNNNRTG	1 cut(s)	359
Sau3AI	GATC	2 cut(s)	184, 366
Sau96I	GGNCC	2 cut(s)	67, 199
SchI	GAGTC	2 cut(s)	106, 360
SetI	ASST	5 cut(s)	44, 201, 228, 241, 261
SfaNI	GCATC	1 cut(s)	220
SgrAI	CRCCGGYG	1 cut(s)	13
SinI	GGWCC	2 cut(s)	67, 199
SmiMI	CAYNNNNRTG	1 cut(s)	359
Sse9I	AATT	6 cut(s)	98, 135, 145, 204, 264, 314
SspMI	CTAG	1 cut(s)	270
StyI	CCWWGG	1 cut(s)	188
TaaI	ACNGT	1 cut(s)	30
TaqI	TCGA	1 cut(s)	54
TasI	AATT	6 cut(s)	98, 135, 145, 204, 264, 314
TatI	WGTACW	2 cut(s)	141, 177
TscAI	CASTG	1 cut(s)	33
TseFI	GTSAC	1 cut(s)	16
Tsp45I	GTSAC	1 cut(s)	16
TspRI	CASTG	1 cut(s)	33
VpaK11BI	GGWCC	2 cut(s)	67, 199
XapI	RAATTY	1 cut(s)	314
XceI	RCATGY	1 cut(s)	52
XmnI	GAANNNNTTC	1 cut(s)	247
XspI	CTAG	1 cut(s)	270

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.