Rmu_sc0005149.1_g000003

Acyl-coenzyme A thioesterase 9

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005149.1
Physical Location & Seq
Reverse (-)
16907 .. 17290
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005149.1_g000003.1.cds

Sequence Viewer

Length: 384 bp
atggacccaaactcatctccttccaattccaccaccaccattccggtagttgcaaccctccccgctttcgggtcggaccctttgacccggaagcccatcagcttgtggcctggaatgttccactcgccggtgacacaggcactgtgggaagcgaggtctcacatgttcgagaggctcttggacccaccagcagacgctcctccgcagagccaattgctaaactttatactgagggagcagcacagggatccttggaatgaggtcagaattgggaaactgcttgaattccttgatgctttagctggaaccatttctgtcaaggtatcactttttagtctttctgtgtttggatttgtgggttttgcttcaaatttggttacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

13.99

Weight (kDa)

5.83

Isoelectric Point (pI)

42.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018167)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 63, 203
AclWI GGATC 2 cut(s) 242, 255
AcsI RAATTY 2 cut(s) 284, 370
AfiI CCNNNNNNNGG 3 cut(s) 68, 69, 127
AflIII ACRYGT 1 cut(s) 162
AgsI TTSAA 2 cut(s) 284, 369
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 2 cut(s) 102, 302
AluI AGCT 2 cut(s) 102, 302
Alw26I GTCTC 1 cut(s) 162
AlwI GGATC 2 cut(s) 242, 255
AlwNI CAGNNNCTG 1 cut(s) 142
AoxI GGCC 1 cut(s) 107
ApeKI GCWGC 1 cut(s) 238
ApoI RAATTY 2 cut(s) 284, 370
Asp700I GAANNNNTTC 1 cut(s) 310
AspS9I GGNCC 3 cut(s) 4, 76, 181
AsuC2I CCSGG 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 3 cut(s) 4, 76, 181
BamHI GGATCC 1 cut(s) 247
BbvI GCAGC 1 cut(s) 250
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 111
BcnI CCSGG 1 cut(s) 88
BcoDI GTCTC 1 cut(s) 162
BisI GCNGC 1 cut(s) 239
BlsI GCNGC 1 cut(s) 240
Bme1390I CCNGG 2 cut(s) 88, 111
Bme18I GGWCC 3 cut(s) 4, 76, 181
BmgT120I GGNCC 3 cut(s) 4, 76, 181
BmiI GGNNCC 5 cut(s) 6, 78, 183, 249, 307
BmrFI CCNGG 2 cut(s) 88, 111
BmsI GCATC 1 cut(s) 283
BpuMI CCSGG 1 cut(s) 88
BsaI GGTCTC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 251
BsaWI WCCGGW 1 cut(s) 43
Bsc4I CCNNNNNNNGG 3 cut(s) 68, 69, 127
Bse118I RCCGGY 1 cut(s) 127
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 251
BseLI CCNNNNNNNGG 3 cut(s) 68, 69, 127
BseMII CTCAG 1 cut(s) 221
BseRI GAGGAG 1 cut(s) 189
BseXI GCAGC 1 cut(s) 250
BshFI GGCC 1 cut(s) 109
BsiSI CCGG 3 cut(s) 44, 88, 128
BslI CCNNNNNNNGG 3 cut(s) 68, 69, 127
BsmAI GTCTC 1 cut(s) 162
BsnI GGCC 1 cut(s) 109
Bso31I GGTCTC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 247
BspACI CCGC 2 cut(s) 63, 203
BspANI GGCC 1 cut(s) 109
BspCNI CTCAG 1 cut(s) 222
BspLI GGNNCC 5 cut(s) 6, 78, 183, 249, 307
BspPI GGATC 2 cut(s) 242, 255
BspTNI GGTCTC 1 cut(s) 162
BsrFI RCCGGY 1 cut(s) 127
BssAI RCCGGY 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 251
BssMI GATC 1 cut(s) 247
BssT1I CCWWGG 1 cut(s) 251
Bst2UI CCWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 144
BstDEI CTNAG 1 cut(s) 230
BstKTI GATC 1 cut(s) 250
BstMAI GTCTC 1 cut(s) 162
BstMBI GATC 1 cut(s) 247
BstNI CCWGG 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 166
BstSCI CCNGG 2 cut(s) 86, 109
BstV1I GCAGC 1 cut(s) 250
BstX2I RGATCY 1 cut(s) 247
BstYI RGATCY 1 cut(s) 247
BsuRI GGCC 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 140
CaiI CAGNNNCTG 1 cut(s) 142
Cfr10I RCCGGY 1 cut(s) 127
Cfr13I GGNCC 3 cut(s) 4, 76, 181
CseI GACGC 1 cut(s) 203
CviAII CATG 1 cut(s) 163
CviJI RGCY 6 cut(s) 94, 102, 109, 175, 210, 302
CviKI_1 RGCY 6 cut(s) 94, 102, 109, 175, 210, 302
DdeI CTNAG 1 cut(s) 230
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 251
Eco31I GGTCTC 1 cut(s) 162
Eco47I GGWCC 3 cut(s) 4, 76, 181
EcoRI GAATTC 1 cut(s) 284
EcoRII CCWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 251
ErhI CCWWGG 1 cut(s) 251
FaeI CATG 1 cut(s) 166
FaiI YATR 2 cut(s) 164, 227
FatI CATG 1 cut(s) 162
FauI CCCGC 1 cut(s) 70
Fnu4HI GCNGC 1 cut(s) 239
Fsp4HI GCNGC 1 cut(s) 239
GluI GCNGC 1 cut(s) 239
HaeIII GGCC 1 cut(s) 109
HapII CCGG 3 cut(s) 44, 88, 128
HgaI GACGC 1 cut(s) 203
Hin1II CATG 1 cut(s) 166
HpaII CCGG 3 cut(s) 44, 88, 128
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 76, 266
Hpy188III TCNNGA 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 1 cut(s) 166
Kzo9I GATC 1 cut(s) 247
LmnI GCTCC 2 cut(s) 202, 235
LpnPI CCDG 9 cut(s) 57, 96, 101, 122, 123, 141, 201, 229, 288
Lsp1109I GCAGC 1 cut(s) 250
LweI GCATC 1 cut(s) 283
MaeIII GTNAC 2 cut(s) 130, 376
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MfeI CAATTG 1 cut(s) 212
MflI RGATCY 1 cut(s) 247
MluCI AATT 5 cut(s) 25, 212, 267, 284, 370
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 6 cut(s) 68, 147, 165, 210, 225, 253
MroXI GAANNNNTTC 1 cut(s) 310
MspI CCGG 3 cut(s) 44, 88, 128
MspR9I CCNGG 2 cut(s) 88, 111
MunI CAATTG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 111
NciI CCSGG 1 cut(s) 88
NdeII GATC 1 cut(s) 247
NlaIII CATG 1 cut(s) 166
NlaIV GGNNCC 5 cut(s) 6, 78, 183, 249, 307
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 166
PciI ACATGT 1 cut(s) 162
PdmI GAANNNNTTC 1 cut(s) 310
PkrI GCNGC 1 cut(s) 240
PscI ACATGT 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PspN4I GGNNCC 5 cut(s) 6, 78, 183, 249, 307
PspPI GGNCC 3 cut(s) 4, 76, 181
PstNI CAGNNNCTG 1 cut(s) 142
PsuI RGATCY 1 cut(s) 247
SatI GCNGC 1 cut(s) 239
Sau3AI GATC 1 cut(s) 247
Sau96I GGNCC 3 cut(s) 4, 76, 181
ScrFI CCNGG 2 cut(s) 88, 111
SetI ASST 5 cut(s) 104, 158, 264, 304, 324
SfaNI GCATC 1 cut(s) 283
SgrAI CRCCGGYG 1 cut(s) 127
SinI GGWCC 3 cut(s) 4, 76, 181
Sse9I AATT 5 cut(s) 25, 212, 267, 284, 370
SsiI CCGC 2 cut(s) 63, 203
StyD4I CCNGG 2 cut(s) 86, 109
StyI CCWWGG 1 cut(s) 251
TaaI ACNGT 1 cut(s) 144
TaqI TCGA 1 cut(s) 168
TasI AATT 5 cut(s) 25, 212, 267, 284, 370
TscAI CASTG 1 cut(s) 147
TseFI GTSAC 1 cut(s) 130
TseI GCWGC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 130
TspRI CASTG 1 cut(s) 147
VpaK11BI GGWCC 3 cut(s) 4, 76, 181
XapI RAATTY 2 cut(s) 284, 370
XceI RCATGY 1 cut(s) 166
XmnI GAANNNNTTC 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.